%PDF-1.3 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf Cartaz - Vacinação - HPardini_2017 2017-08-25T16:00:19-03:00 2017-08-25T16:00:19-03:00 2017-08-25T16:00:19-02:00 Adobe Illustrator CC 2015 (Windows) 184 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAC4AwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9S3TtHbTSLsyIzKfcCuA 8mUBZAfCdzc3F1cSXNzI01xMxeWVyWZmY1JJPUnKH2uEBECMRQDKdN8v+WLLyzaa75ke9kGqTzw6 daaeYkbjbcBLJJJKsg+1IAFA+nF1mXVZ55pYsPD6ADIyv+K6AAru5pt5c/KW6vLzy9c6jMDoWuzi D1LUus0bPA06KTNCqE8U6pyGxGIcXV9uRhHJGA/e4xe9Ud66Sv50gdG/KTzRq9vZy20lqj3ixSi3 kkcSRw3HIQzSURlCyFaChLbioAONt+o7cwYjIHi9Ni62JHMDfp8lp/KvWgi3X6R046QbY3bayJnN oqrL6BQsI+fP1fhoEONp/lrH9PDPxOKuChxcr76qt+aeXP5QQPr/AJi0/T7iSePSLSKS0iLEySzy 2sdx8cqw+ksY5PSvEtso68sSXCh26RixTmAPEkb8gJGPLiu+XfW58kvm/KS/tbLU0mvLe51e1Sxa 2srOQueV/cRwxrNzROJYSgrvgtvj25GUo1EjGeOzIfzIkmt/LdJNf8i32hrBPdXtrc2Ml09lcXlm 7zLBcRUMsUgZI25qrV2BB7HDbmabtKOaxGMhLh4gJbWDyI3OycD8sbWZ9NuLPWfV0e+tLy/mvJbZ oZYYNP8A75/QLsXB6J8Q5e2NuL/LEgJCUKyRlGNCVgmfLetvPbZTuvy2toE1VhrKyGy0yPWbBBbu Dc2kwj4u1W4xGsoBFWP0b4LTDtcy4PR9UzCW/wBMhfz5eSHi8kaRdeURrlhq8s96Z7ayj06Sz9JZ Ly4oXhjm9ZuXprVuXDw6Vw22HtHJHUeFOAEalLi4rqI6kcPX3oq68g+X55PMEWk6073OgxTTS280 BMbra0SU/WVKKDJJX014dKCtcALVDtPKBjOSG2UgWD/O5enyHPdvVvyxtdMguWn1tBNpM1rB5gT6 vJxtTeIXQxsrMZwCvE/Cu/tiSuDtiWQise0xIw9Q9XCd7/m9/MonTvyhlvfNOu6FHqTOdFkiiLw2 3qTS+s3H1BCZUCxp+23M08Dhtry9uiGDHlMf7wE7y2FdLrmemzBNTshY6ld2QlScWs0kPrx7o/ps V5rX9lqVGId3hyccBKq4gDXvTjyB5TbzX5ssdE9UwRXDM1xMKErFGpd+IP7RC0HvhcTtPXflcEsl WRy95ezTfl9+Wc1nY6Ymh+jNqBjjttSh1FJGDPM8TH1ObRs6KnqcONG3VfiBGRsbefm8hHtTWCUp +JYjdxMK6A8qujyvmOZ2Ly9fyl16XU9SsYbq0Dadc3FsfVkZXf6uiyc1jVXYh0kFKd9jTaqZU9Ie 3MQhGREvXGJ2Hftz25EI1/yO80rE0v1/TWRRy+CaVyV9T0+VFiJp+3Xpx38ceINQ9o8BNcM/kO6+ /wCHvYDfWj2d7cWkjK8lvI8TuhqhKMVJU7VG22EO8xzE4iQ6i2UflLeXVr+Y2gtbytEZbpIZeJpy jkPFlPiCMXW9uY4y0mSxdRv4h9jZkPkqncxtJbyxr9p0ZRXxIpgPJlA0QXxLd+UvNNpcy21xpN2k 8LFJF9CQ0I8CAQR7jbKLD7HDXYJASE40fMJ5oup+btN0o6TP5dXVtOEpuILfULOeQQysArNEyGJl 5ACorT2wWHC1GHT5MniDLwTqiYyAsed2nv8AysX8yedhIdAQy6fcQ3ayfVLoGSWC2e1QyAPxp6b7 hAu4+dUEBwv5K0fqHibSBH1R2BkJbbd462t0v8xfzR06x020TSpZo9LWOO3MsN6A0cO0aSRRyxws F234cthvjxDvTm7K0WSUpGYHHd7w5nmQSCftpL9M8zeerHRrbRToAu9Lt7eW1e0ubS4dJkmuPrPK Xiynkkn2CtPeuJIb82k0s8hyeJwzJBsSjtUeHb3jndpmn5j/AJkrdXdyfL8bPdyCYg2dyFjcWi2R MYVx9qFB9qu/SmJILjHsrRmMY+IfSK+qO/q499u9LJfNP5hve6peppDw3Oqiw9WSO1n/AHbaY0bQ NFyLUNYF5cq19seIOTHR6QRhEzsQ4/4o78d3fz25KOua35y1g2qT+XVhtLe6a/lsYLO4SGe4kK+p JMCzMeYWh4sNulMbDPT6fT4rrLcjHhsyjYA5Ae74o6/85eebvV7bVR5Zhtp4IJLOSKG0uxDNayJ6 Zt5I3kcemF+yE40riSGjFoNLHGYeKSCRLeUbEgb4ga5++0vuda893F7qV0+juv6S08aSYEtZ1igt VMZRIFrVePogDkW742HIhp9LGMYif0T474hZlvz+fkstNU862o0NIdFkWLQDJJZRC2uOLTysWNxL vVpA3GnQDiBTBY70zw6aXiXkF5av1R5D+EeX61ax1rzXaeVrjy5/heOe2uyz3N3La3n1mSRq8Hd0 kRWMfL4KrQdaVw2GGTT4JZxm8Ugx5ASjwjy5deu7te8wefNa02SxuNFaH6y8Mmo3UFpMk129snCJ p2PIHiD+yF33xsLptNpcMxIZLq+EGQqN7mv22irbzf5/h1vVdWbQRNJrE0NzdW0lpcmFZrZucLx8 WWQFG3FXI8a42Gueh0hxwx+JXhggHijdS5g9N/cxXUNK81ahf3N/dabdvdXcrzzuLeQVklYuxoFo Kk48Q73Z4s+DHAQjKPDEUPUOiaeS5vNnlXzLZa5baRdStasfUgMMoEkbqUdK8TSqtsex3x4g43aE cGpwyxGcRfWxsej2yw/Mrytpely3cGh6tfaxORJIk1jwkLKxaKPmq+mkcRb4Qtadd2JJMZxDxuTs nPkmInJjjjHdPbzNcyT1v3cqeY6f528722oXN7P5da9a7vbjUJop7aRkMk8axKv2ahY1B40PfIGu 96TL2fppQERl4eGIjtIdDff1R9v+YnmmCNUXyizBIYbdQ0UxBSByyM3wfE4B4hidsFDvDRLsrAT/ AH3UnmOvx5JN5w8w+aPM2nR2cvlp7P05Vl9SCCUE8PVoCOA7TbnvTCKHc5eg0uDTzMhlEtq3I8vP yWflT5U8ySfmBosv6NuY4bW5Se4lkidESOP4iSzAD2HvkxvyZdta3CNLMcUbMaG763zIfLHYqo3c rxWc0yU5xxs68ulVUkVpTISNRJZwFyAY/wCRtZ1HUbS6i1C4iu57aUhbmILGWRySoaJWenGlA3Rh 71yjTZTMG96cjV4RAiurJqDMpxEsuvMeh2mqppVzdrFfSRGdY25BQgV2q0lOC/DC7AFqkKxGynK5 ZYg0Tu5UNHlnj8SMbjdfHbpz6j5jvbHmHQ2l06OK7Sb9LmRdOkh5SxSmJDI9JYw0YoiE7tvTbHxI 2N+a/lMoEyY14dcV7EWaGx35uj8yeW5Sgi1WzcyerwC3EZ5fVxWalG39Mbv/AC98Rlh3j5rLR5xz hLp/CevL59O9GWd3Z3ttHdWc8dzayjlFPC4kjYdKqykg5KJBFhpyY5QkYyBjIdCKKtQZJrdQYq10 wJSzzPri6FoV3qrQNcm3VeECsELvI4jRSx+yOTipoaDsemCcuEWyhHiNJP5R83XepS/U9UNqL6RF niWyZ2QRSc+IbnU/7pej9DToppWvHkvm25cPCLDLKZc46DvdW0+yu7K0uZDHPqMjQ2a8XYPIiGQq WUFVPBCfiIrTISmAQD1bsennOMpRG0BZ5crr7+5SvPMOiWkHrzXamIXSWLvFymCXMjiNYpPTD8Dy YA8qUrvgOWI69a+LPHpMszQjvw8W+3pG9i+e3ch7Lzj5YvbGS/i1CNLKK5aya4uOVuhuFIBjVphH z3NAVqD2yMc8CLvZsy9nZ4TEDE8RjxUPV6e/a6+Konmvys8Edwms2LQTO0cUouYijuih2VWDUJVS CQO2Hxofzh82J0GoBIOOdj+if1JlBNBcQRzwSLNBMokiljYMjowqrKw2II3BGWAguNKJiSCKIX0w sXUxV2KuxV2Ksa8+XusW+gtFpGny6jeTkKIogBRQQT8bfCpJpQsKdzsMxtQZcNAc3M0cY8RlI1X2 pN5QsfMkHmASS2ax2ISdLq6mHpPU8OKxoB8bM61L048ffbKdPjnGe42b9XkxyhQO7PqjxzPdYlWo eV9A1C//AEhd2oku/Ra29Xm6/u3V0IorAcgs0iq1OShmoRU5VLFCRsuXi12bHDgiajd9Oex+8Dbk aF8lmmeUvLumWmm2djaCG30iSWbTo/Ukb0nnWRZDVmJbkJ32ao39hhjiiKroyza/NllOU5WcgAls NwKrp/RHJK4vyr8gRlSulKeD3EgDTTuOV5GsM5IaQg80QDfp1G+VDS46qnKl27rD/H/N6R/hNx6d CyHS9MsNLsksrJDHboXcBneRi0jl3ZnkLOzM7ElmJJOXwiIig67PnnllxT3Py5bDYbDZF1Hjkml1 R44q0f4HAlh/5pJfXWg2um2kbSC/vYkuHQkPHHAr3SyBlV6Ult0B23BoCpIYV5j6W7Tj1MH8m61q sF9Y2k+hXdnLMzPRbb07OOWIMS9FjDD6xXkeTmh+840CR0d1qtIIxPqgR5S3N159PcOr2eOQPGrg EcgDQ7EV33zNBefIpQu9PsryW0luY/UksZvrNqeTDhL6bxctiK/BKwodt8Eog8+jZjzTgJCJ+oUf dYP3gICPyl5djivYltaR6heJqN4DJKed1HIkqyVLVFHiU8R8O3TIDDAXtz3cg9oZiYni+iPANhtE giuXcTvzQ195B8p6hpk+mX1o1zaXNwLu4EtxcNJJOFCB3lMnqGigKByoABTpkTp4EUffzLZi7V1G PIMkJcMox4RUY0Bz5VXPyQ7/AJY+RntxbnTqRBVSiz3CkqkcUSqWWQMQFtoiKn7Shvtb4DpcZ6fe 2DtvVg8XHv8A1Y98j3f0pfAkctmR2VpbWVnBZ2y+nb20axQpUtxRBxUVYknYdzl0YiIocg63JklO RlLmTZVqjJMHVGKuqMVdirsVfOegeWrKztpo9YNrq00nL0p1v9StTGCFC0VLV1PEgnfxzQ/6ItH/ ADvsl+p2P8jajuHzCF13yk15cpJpV5aaVCFYPB9a1C4DEyOynlJbAjijKnvxr3x/0RaP+d9h/Uv8 jajuHzCW/wCBNb/6mC0/4O9/7J8f9EOj/nf7E/qX+RdR3D5hM9A8l3ttdyXGoapY31jDGXubaS5v 7dCgZalpVgVkp1qP1ZKPb+lkaEiT5Rkf0NObs3NiHFICveyVPK2gXMRe106yeJuQWVNa1J6H4waM LXj8JZe37O/U5DL7R6PGeGZlE9xhMfoccYJHl97Ff+VVea/+r5Z/8jbz/qhlX+inQfz/APYy/Uv5 abv+VVea/wDq+Wf/ACNvP+qGP+inQfz/APYy/Uv5abv+VVea/wDq+Wf/ACNvP+qGP+inQfz/APYy /Uv5abv+VVea/wDq+Wf/ACNvP+qGP+inQfz/APYy/Uv5abOvym8l63ompanNfajb3aTWTRIsTzsV Ysp5H1Y4xTbtmdoe2dNqiRilZiLOxH3hBwyjzYv5c8u6dYW0setJZ6zOz8op/wBIapa8E404cYrY g771zH/0RaP+d9kv1Of/ACNqP5o+YQXmHyn9evlm0a7tNHtRGFa0+t6jdVcE1cPJbKwqCBT2x/0R aP8AnfYf1L/I2o7h8wln+BNb/wCpgtP+Dvf+yfH/AEQ6P+d/sT+pf5F1HcPmE10HyJryyNP+mbOe 2tZIrm+jN1d2qNbRE+qrTNCnAMDSo6dcy9J2pg1EjHGbI8i4+o7Py4Rcxt72XSaTpJMR+rafGrhS nHzPe/HzZeHEtG2zUKinXl45sLDi8LDY/wAv/Ocs0cEPmqwlmlkMKRx6jK7GQBiUoqnf4G+7BaOE pj/yp380v+rxD/0l3H/NGDiCfDLv+VO/ml/1eIf+ku4/5ox4gvhl3/KnfzS/6vEP/SXcf80Y8QXw y7/lTv5pf9XiH/pLuP8AmjHiC+GU58m/lf8AmHpfmjTtQ1DU45rK3mDzxLczuWWhFOLIAfpwgrwE PbcsS7FXhOm/or12/SZnFvx+H6sEL8uQ68yBTjX6c8i0vg8X77i4f6NXfx8re/z+JX7vhvzv9CZf 86PQbanWnxb29CaHp9NMzv8AW/8A27/YON/hf+1/7JIs1DnphpEthEt9JqChrJbVzcKd14B05cgV eop2pmRpoylKoCRmarhlwm7HV1Xa9eEL/nfoKOt/MHlC2trcWytDaz0MPpIyp8ZULULEAvIuKVzI y9k6jLImcMkpDvywJ698ejzgyxHI/YnCyWbKGWOQqwqDzHQ/7DNHPwYkxMJ2P6Y/4huFt8rT/fcn /Bj/AJoyPHg/mz/04/4hd3crT/fcn/Bj/mjHjwfzZ/6cf8Qu7uVp/vuT/gx/zRjx4P5s/wDTj/iF 3TvyuYTNd+mrKfQNeTBu/sq513sjLGcuThEh6Osgev8AVDVlvb3vLc597d2KuxVk/kiewt21SfUA GsY7RmuQyGQFAwLVQBi23amdP7Lf30/6v6XS9uf3Y9/6E6j8wflZLb20iQ2rQgf6MPqL/D6ciRUV fRqvGQqKf0zuHl7iqWPmL8tLS6S20+O2gnikURiC0MYRpomcMGWJVHKPluD0274rxBNfLvnPyz5j e4j0a7N09px+sD05Y+POoX+8RK/ZPTEhkJXyTv4fA/fgZO+HwP34q74fA/fiq6KnqLt3yUeaJckV lzS7FXhn6ST/AJYrb/gX/wCas8k/ND+ZD5H9b33gn+dL8fB36ST/AJYrb/gX/wCasfzQ/mQ+R/Wv gn+dL8fB36ST/litv+Bf/mrH80P5kPkf1r4J/nS/HwTvypcfWLm9EWmQ3E0do8kNujGIyOrpxTmz ELWvU5uOxceLU5ZQyQjw8N9e8ebq+14GOIEEn1foKd/7lo5SqeTwYaM5db2EMWDPtxJG7BVINf2t 6UOdNLsPRy54wfn+t5zxJovRoLy6eNdT8uLpodGd2F0k4RhxAQ8KElqncbbZH+QNF/qcft/WkZJJ x+hdK/5Zk+9v64P5A0X+pR+39bLjl3u/Qulf8syfe39cf5A0X+pR+39a8cu936F0r/lmT72/rj/I Gi/1KP2/rXjl3q9tYWdss7QQiNmjYEivT6TmXpezdPp+I4oCJIYmRJF97x7T9TNl/wAettcjkHpc R+p0FKdRsfDPONNq/C/hhLf+IW9tmwcf8Uo+40iYtfEbVGm2LfEG+KGo2rtu3TfL49o1/k8X+l/a 1y0l/wAc/m7Udf8Ar1v6H6OsbUbfvLaD032IP2qk46ntHxY8Ph4oecY0fmuHSeHK+OcvebVvK+o3 lg91PZoss/phVjc0Bqa0rvTpkdDr5aY8QIjZAJI4qG55WO5w+2I3jHvTced/OBaMfouIhgfVcSKA jggUAbiWBqd/b3zey7fA/wAvH/lWTt8DsfxTzfAe77UbZebPMEkZa7t4beQEAIp9QHYEmtF71Ga3 V+1OaEgMU4zHfwGP++bI4r57Ij/E+p/8V/8AA/25i/6LtZ/Q+X7WXgh3+J9T/wCK/wDgf7cf9F2s /ofL9q+CHf4n1P8A4r/4H+3H/RdrP6Hy/avgh3+J9T/4r/4H+3H/AEXaz+h8v2r4IRek6/f3GowQ ycODtRqLQ9Pnmx7I9pNTn1UMc+Hhke79rDJiAiSy7PRXCdirwiwuLKGRmu7X62h40T1GjpR1Zt1/ mUFfprnkOnyY4n1x4xt1I6ju7xY+NvoGWEpD0y4fhfT9e6NvdS0Ca1ljttG+q3DcfSnFzLJwoQT8 DCjV3GZWfVaaUCIYeCXQ8cjXwPNoxYM0ZAyycQ7uEBKM1rmMl8iQ3c9/fw2dz9UupLKRYLrgJPTc vHxfgxAah7HOk9l/8Yl/UP8Auoun7b/uR/W/QWV2fl7zhC/O481SXJCqAptLdFrwIfZadX+IdxQC tK17x5aj3slr8XHkOVK0qK0wMm/i8fxxV3xeP44q74vH8cVbofSlqf2D39seh9y9R73iP1Cf+aH/ AJHw/wDNeeT/AJeXfH/TR/W934o8/kf1O+oT/wA0P/I+H/mvH8vLvj/po/rXxR5/I/qd9Qn/AJof +R8P/NeP5eXfH/TR/Wvijz+R/UmmiWl+i3Qt7lLeZ0CpMksTFTvvTlvlsBPEOLauIWPEEbFHaxJ1 Xa0hKAG/PuKvDpnm4XVs83mNpbaNV+sQAQoZXWp5c1eqAmnwj+OZeTtO4kRgIy3o/mLq/Li3Pmf0 PPjH3n7E556h/wAtP/Jdf+as0vHqv9U/6Wx/4puqPd9jueof8tP/ACXX/mrHj1X+qf8AS2P/ABS1 Hu+x3PUP+Wn/AJLr/wA1Y8eq/wBU/wClsf8AilqPd9jueof8tP8AyXX/AJqx49V/qn/S2P8AxS1H u+x3PUP+Wn/kuv8AzVjx6r/VP+lsf+KWo932I3RWvTqltzn5Jz3X1Vau3hyObXsOeoOsx8WS43y8 QHp3cTXlrhOzN89UcF2KvBeFl/v2T/kWv/NeeP8ADj75f6Uf8U+hXLuHz/Y7hZf79k/5Fr/zXjw4 ++X+lH/FLcu4fP8AY7hZf79k/wCRa/8ANePDj75f6Uf8Uty7h8/2J15WvtI0+e+uLt5Htfqcizjg F+AsnI1Dk9M2/YuphgzEgSmZCgAB1I75Op7Ys4hdfV+g+SDuNY/I1LqHUZbR0mhMaW8gFyApgCOg VFeg4gr+z/HOyGtynlhyfPH/AMW8vUO/71GSb8hxAIJbGZI7MCfjyu6qLgIQ1Vkqa/B32xOuydMU zZI54+l98x3I4Yfi2TWH5nfl5plvLaWsk0ENuDcSRmKVuInYNyq3I/E0ladvDInXZNv3Uzfnj/4t mDEdfvZBaeddGu7dLi29SWGQVR1C0IP+yzVaj2ow4ZmGTHkjIeUf+KbY4yRYVv8AFWn/AO+5fuX/ AJqyj/Rjpf5uT5R/4pPglGabrFrf+vHErqVjLEuBSnTsTm07L7cw60yjASHDG96/QSwnAxI97zPT 57Cy/wB22lyOQelxbySdBSnQbHwzkNNkxYuuOW/8UCXr80Jz6Sj7pAK0eo6ckiyU09uJrxa1lK/S MtjqcQN/uv8ASSazhmRXr/0wXajqen31v6HHTrUbfvLa0kjfYg/a3OHU6rFljw/uoecccgfmjDgn jlf7yXvkCt0fSbK5gv4xqqW8YhLS3XxQ+kvQuHccVIr1yGh7N8eVY5QkYkSqUTwmrG/zcXtbIfDF gjfvCpa+TNMEb3w82tNDbBOc/wBdDRIsTU+Pqnx+mQ5brQ9M32TsbMRwiGmAPP0Hn9lV07u8vPCQ 52fmySz8qSm0h9K9juIuC8JyS5cU2YsBQ18c02X2PzTmZceONm6AND3eTcMwpV/wndf8tEf3N/TK /wDQZm/1SH2p8Ydzv8J3X/LRH9zf0x/0GZv9Uh9q+MO53+E7r/loj+5v6Y/6DM3+qQ+1fGHc7/Cd 1/y0R/c39Mf9Bmb/AFSH2r4w7kVpnly4tr+CdpkZY2qVHKp2+WbDsv2Wy6fUQymcSInzYZMtxIZT neOG7FXhFhY/W5Cn1iG3px+Od+Cnk6psaHpy5H2BOeQafB4prijH+sa5kD9N+630DLl4BdE+73X+ PNG3vl76ray3A1OwuPS4/uYJ+UjciB8KlRWnKpzLz9m+HAy8TFKukZWT7hTRi1nHIR4Ji+pGyUZr XMT/AMnxwNd3rzRSzJDaPJ6VuvKVuLpsi9z7Zt+xtBj1WSWPJfDw3t74up7Zlw4gf6X6CmM2u6bF GHPlnzC4LFQqWfJ9lViSOWw+Og36g+GdD/oR0f8AS/037HmfzB7lzazYIJvU8ta+TDHFL+7teYf1 QhKISVqyc/iHahx/0I6P+l/pv2L+Yl3NtrOnqZw3lrX6wRrJ8NqGD8+PwIQ27jn8Q7UO+P8AoR0f 9L/TfsX8we5MLJtMu7yK2XSNWiEqo/1iaH0ol5qrUYsQQV5UIp1Bx/0JaP8Apf6b9ifHKd/4Z0z/ AIs/4L+zB/oS0f8AS+f7GXilF2Gk2lkJ3h5cmiZTyNduubHs/sXBpDKWO7Ma3LCUySPe8lsLvS4V QXdh9bZXZnPrPHyQhaLRRtQg7++cFp82GIHHj49/5xG2223x+b2uXHklfDLh27rUb6ezmdDa2v1V VTi6+o0nJuRPKrdNiBT2yvUZMciOCPBt33fmyxRkAeI8XwpDZQ2sm8km2Dambq1a9txaky2ixiZp FDCqiM1518M6f2W/vp/1f0ul7c/ux7/0JrZ+YtECR2ieTdVjt7i4aOj6eOIZm5NLJyJohMxPI/5W dy8vfkibbz8kdqwXyrrkMUEStFAllvx5+msaKCAGVaNx7DBSeLyRP+OqQ3UjeXdarbCJvTFqGaT1 RWkYDfEU/b8MaXi8kbaeaVutRNkmkanGA7J9amt/Tg+E05cnIPE9RtjSeJO/h8D9/wDZgZO+HwP3 /wBmKro+PqLsevjko80S5IrLml2KvDP0Lqv/ACzP+GeSfkM380vffmcfe79C6r/yzP8Ahj+QzfzS v5nH3u/Quq/8sz/hj+QzfzSv5nH3sh8lafrVtfXkkEKpcm0cW5nqIjJzQqH4Vam3bOg9nNNkhnkZ ChwH74uq7YzRliAB/i/QU4mX83PTBh/QRlLHkH+ucAvFaUoK15cq79Ke+do81v5K9un5mLLIJ20l 4eEPpEfWQ/qVj9flQBeNPU4U78a98V38nW6fmcbYfWW0dbnmA3oi648OS1ILH7QTnTbrT3xXfyTD Tx5v/Scn6R+onTOLel9XEwn5UTjy5/BQnnX/AGPvikWm9G98G7LZcOQjlr/Ievyw9D7kdR73iP1+ f+WH/kRD/wA0Z5P+Yl3R/wBLH9T3fhDz+Z/W76/P/LD/AMiIf+aMfzEu6P8ApY/qXwh5/M/rd9fn /lh/5EQ/80Y/mJd0f9LH9S+EPP5n9ab6Bq+qwC7lsYkkuVj+CKOOKMv348uNBUjvmVpddmgfRLw7 IBkIRNDfpW7qe1sYEBzO/eUyPmrz0HA/R3JSSCwkh2AZADQxjqrMf9jTuM2Q7Sz/APKTL/lR7/L3 fP3vP1/R+1fpfmnzrcyyrfWDWEaAem5aCbmTWooi7U98p1vauqxxBxZzllfLweGvnFlCIPMV8Ux/ Tevf78P/ACKT/mnNd/L3af8AOP8ApI/8Sz8OLv03r3+/D/yKT/mnH+Xu0/5x/wBJH/iV8OLv03r3 +/D/AMik/wCacf5e7T/nH/SR/wCJXw4u/Tevf78P/IpP+acf5e7T/nH/AEkf+JXw4ovSdW1iXUre OZyYmajj01G1PEKM2XY/bGvy6qEMhPATv6Ijp/VYZIRETTMM9IcJ2KvA4La5uHKQRPM4pVY1LHdg o2HizAfM545jxSmaiDI+W/l9+z6HOcY7k0rz6Pq9vE01xY3EMSU5ySROqipoKkgAVOXZNFngOKUJ xA6mJDXDU45GoyiT7wg8xm5kXktLd7rUUubprK3axlEt2knotEvNKuJP2CP5u2dJ7L/4xL+of91F 0/bf9yP636CnNpaeVZHto7fzvd3EluvHbU0k9T/dn72gILcUJHfjXtnePK7d6faV5U/R80czazqV 6ySNIVurjmj81YcWRUReI51AAG4HhgZAJ5QeI/HAydQeI/HFXUHiPxxVun7qXevwN+rD0PuR1Hve Lafd6bBT65Y/W6NU/vXiqtB8Pw/rzyvT5sUPrhx7/wA4j4bPcZcc5fTLh+Fqd9PZzOhtbX6qqpxd fUaTk3InlVumxAp7ZXqMmORHBHg277vzZYoyAPEeL4UhsobWU+Q4buafUYrS4+qXT2pWC5KCT03L Cj8GIDUPbOn9lv76f9X9Lpe2/wC7j7/0J+3lzz6Zuf8AjALF6XD0xp1v/eGPj6nIsT/efHx+jO4e Yo96q+i+cZrmJ4PNai3Rw0sIsbdi6eoW4h+Xw/B8Fadq4rR72TVWvGo5daVFdsDNumKuO3UgYq6m Kr4h+8X54Y80S5IrL2l2KvBLe7urZy9tM8DmgLRsUOxBG6kdxXPHceaeM3AmJ8jT6FPHGQqQB96t Nq+rTxPDNezyxSUMkbyuytSlKgmhpQZbPWZpgxlORB6GRYR0+OJsRiCPIIPMZuZF5Ll06K51KTU1 V9PSwlN0joZVMYdOQMYDFhTtQ1zpPZf/ABiX9Q/7qLp+2/7kf1v0FPYvNP5UxacNQiW2SxZQPWSy cLxRlhVSBDXYkKB4dNhneU8rxRR0/wCZnke3tWu5tQZLZWRPV9Gc1aRBIoAEZb7BBrSn04KTxhP9 N1Kw1Owgv7GQzWlygkhloV5KehowDD6RiyBtE/D74Nk7u+H3x2XdcOPpy9fsH9WHofcjqPe8dsdE F+pa1aWQK6Rn4IlPKRgqijTA7k55jp9B4wuHEdwOUeuw5ze0y6nw/qofPp/mqmpeXZdMRXvvWhVj xU8Im3BI/ZmP8pyeq7NOAXk4o/CP6J+THDrBl+ij8/8AiUv9PTv9/wA3/Ilf+quYXDi/nS/0o/4p ybn3D5/sT7ytDoDw6smoSO+nNaN9cDoUHpchy3jdm+7Ol9mRAZZcJJ9PdXX3l03bRPhjiA59/wCx u11P8l3ht7FZRNG906WyyR3RVrh5ObADiB8LTChpTpvtnabvM+lBCf8AIm4sCkzM1rao8qllvUpH PcD7Ii47eoFoKVA+nHdHpRrS/ksdMvreTktlAIHvEYX1QHVBAf5qlUXpv471x3T6Uy0y3/KyTW7q Gw5TapdykXVGvJOUiMQauxKChc9DTFI4bThvy88mOjpJpwkR5vrDB5JW/e/zfE5p4UG1NumC08AZ EqoqhV2VRQD2GBmvip6i798lHmiXJFZc0uxV4P8AWoP+WOH75v8AqpnkHjR/mR/2X/FPoPAf5x+z 9TvrUH/LHD983/VTHxo/zI/7L/il4D/OP2fqd9ag/wCWOH75v+qmPjR/mR/2X/FLwH+cfs/Um3l3 Vp7Oe6nsrOM3C27cEVnBf40+GsjsormZou0PAkZR4ce1GVSlQsdOJ1fa2M+ENyfV5dx8kVL5+8+q gaPy8kjE04fWoVoAqmtT4kkfR75uh29D/lJj/wAqZ/rec4JfzftC5vPnnxfUpoMcnFEaMi5iXm7B ea71pxqd+9MT2/A8tREbn/JSPfXUeS8Ev5v2ubz557BlA0GNgiK0RFzEObnjyTfpxqdz1p74D2/D b/CI/wDKmfz5/YvBL+b9qb2nmvWpbdJLiGO3lYVaHZyvsWBpX5ZqdR7VaiMyMcozj38BF/C22OKx urf4m1P/AIr/AOB/tyj/AEW6z+h8v2p8EJt5c1W6v7iaK448BHX4RTqQPHOk9m+2c2syThk4aEeg 82nNDhAIa/5V75W/5ZW/5Gyf1zb/AOhzR/zT/pj+tyv5Y1Hf9gQuoeUvIWnRrJqDRWcbnij3FyYl ZqVoC7CpoK4D7O6Mfw/7I/rUdr6g9fsCKH5feVSARbMQeh9WT+uP+hzR/wA3/ZH9a/yxqO/7AjdK 8raNpcry2UJjeReDEuzbVr3JzL0nZWDTyMsYonzLj59flyipH7Ez9BPD8cz+AOLxF3oJ4fjjwBeI u9BPD8ceALxF3oJ4fjjwBeIu9BPD8ceALxF3oJ4fjjwBeItiJAQab4REKZFfkmLsVeEWFxZQuzXd r9bU8eKeo0dKOrNuo/aUFfatc8h0+THE+uPHy611F8u8bfG30DLCch6ZcPwvp+vdG3upaBNayx22 jfVbhuPpTi5lk4UIJ+BhRq7jMrPqtNKBEMPBLoeORr4Hm0YsGaMgZZOId3CAlGa1zGTeQ4LifUb2 K3mFvcPZyCKdkEgRjJHRuDEBqeGdF7MxB1Er/mH74un7b/uR/W/QU+l8reenXhD5wWOUGrt+jbZv hKqFHEtQfErGvevtndeFD+aHlqPe5fLHnJ1lNt5vUK8USwn6hbycHVU5yVZjy9TiTQ9OWPhQ/mha Peufyx51X6wy+bgiPGqxctPtj6bjjzkqW+LlxbboOXsMfCh3BaPemNlonmKO8ilu9cW4t0VBLbJa QxB2CqGblV2HJgTQdK4PCh3BNHvTz0k/lX8MfCj3BlarbIqsxAA27UyzFAA7BhNE5e1vFPMNtpXn H8wtbe+K3en6FCmm2tv6rxIJ6GSRnUeEvJC3+SNjmHlkeJzcEBwsy/JzUkn8pPpnrPcS6Be3OlvN I3JmEEhMZFSSFCMFUeA22y/DKw4+aNS2ZzlrUwL8xL3zfFrmhtodrezWVjILzVDaA8JI/Wjj9JxV fU/dGRuChjXiaU3zC1MpiQ4QaG5rq9B2Rj0xxZPFlASkOGPF0NE2O7fh3NDnulp8z/mDD5qvLuTS rltNVks2tltrp40iSW84yx8SyyyPSAvJGOPFqEfDXKzmyiV0fkfx8XJ/I6OWnjETjx7yviiCTWPY 9wHrqJ3sX1pAaP5j/NeG7nvp7Cd4LtDObCW0uGWOZraxLCMlvURIy8zLH+0VdN3aqxGXMLNH3UXI 1Gj7PMRASjcduISjuOLJz6Emo79AYy+kb9I8rahq2oaLFdarbfVbtnlUp6bw80SRljl9GUtJF6iA Nwc1WtDmdhlKUbkKLzWuw48eUxxnijt1B6bixsaO1jYptlrhuxVxxV2KuxV4Hxtv9+P/AMAP+as8 dqHefl+19DuXd+Pk7jbf78f/AIAf81Y1DvPy/aty7vx8ncbb/fj/APAD/mrGod5+X7VuXd+PkyHy ZDpUl1qEd7JSyeykFy0h9FRGXTkTIHBX51zovZkR/MSon6D084+bp+2r8EX/ADv0FMpvJH5Qz8bS QWrEEyLD9elBqQEJoJq9IafQffO5svL8MUZpvlD8tLmd59OWC4lmjhRmgu5JOSW5jaLZZW+z6SfP v1xspEYoq1/LXyRa2628GmhIkcSKPVmJDBlfZjIW+1GppXemNp4AmGn+U/L2nalJqdnaejeyhlkl DyGoYICOLMV6RL22+k4LURATbbFkuEgijllpXghanStBXJwYTec6H+cWq61ay3OmeWJbqCEkSMb2 3Qgrxrs6oTT1F7d8stptA+atXnsbm+13WvJsiM0RSS+ivrVZBCOFueEkKLccS0qEAmoJqKU2rljB NltjnlEbJHpH57aLo+nR6fp+iXMNrCf3SG6Ryq0oE5PEzFR2qdtgPhAGEChQYyy2bIZDoP56Tazd R2GneX5bq+kbjFG11DGWojyt8TJGg4rGckCx4r6Jzc/mP5rtrO4vJvJ0621qsr3En122PBYPU9Qk AE0HoP8AOm3UVNrbF/8AoZWx/wCrFL/0kL/1TwWjid/0MrY/9WKX/pIX/qnja8Tv+hlbH/qxS/8A SQv/AFTxteJ3/Qytj/1Ypf8ApIX/AKp42vE7/oZWx/6sUv8A0kL/ANU8bXiTHy9+ftnrOuWGkro0 kLX06QCUzqwUuaVpwFcbXiesZJk7FXz9njL6K7FXYqyLyU8CXWovPaNfQrYyl7ONFkaUc0qio1FY t0oc6T2X/wAYl/UP+6i6ftv+5H9b9BTttT8tPp/15vJF8wdWDW502L16NIVZDGTX4vUZ/ClSeu/e PK/D7FSPzDo+mW4u7TydqURi4wRR2unoswSVFkYBVK0QEKG3+0Om2K35Mr02+W+sILz6vNa+ugf6 vcr6cyV/ZkTfiwwMwiar4fjgS6q+H44qu2MUoA6o36sPQ+5HUPHNP0TReC/pG2n58zy+riCnCgpT mftVrnAabPkr97PPd/wzHL4nnzepzYIfwQxfGPX4BrUtE0bhB+jLaf1KH6z9ZEFK7ceHA/OtcdVn y1HwZ5r/AIuKf3UfenDghZ8SGKulR++wgf0I/wDyyp9yZh+Prf58/wDTn9bf4Gm/mR/0o/Un3lTQ JZDfrHYWc9z6HK2S9QPB6gYULcQzDYncDOg9n8meWSXiSkRw9ZX197qu1sWIQHBGIN91Mv0TypAL Ff05pekNfmvMWVqFhG+wBl5MdvlnVuhAHVMP8LeW/wDq0WX/AEjxf8047poO/wALeW/+rRZf9I8X /NOO60Hf4W8t/wDVosv+keL/AJpx3Wg7/C3lv/q0WX/SPF/zTjutB3+FvLf/AFaLL/pHi/5px3Wg q2vlzQILmOaHTLSKWNgySJBGrKR0IIWoOEXakCk6y5qdirwew1G8sJTLaSenIeILcVb7DrIv2gf2 0U55Bp9Tkwm4Gj8OhB6+YD6BlwxyCpCx+yvuKOvfNnmC+tZbW6u/Vt5uPqIUjFeJBG4UEbqOmZef tfU5YGE5XGXPYfqaMXZ+HHISjGiPMpRmtcxkvkT9IfX7/wDRwiN99Sk+rfWOXpepzj4+pw+LjXrT Ok9l/wDGJf1D/uoun7b/ALkf1v0FlVtH+ZgLNcyaOSFHFIo7kKWKHlUsSdpKUPda7VO3ePLbtwj8 zPTiMx0b1KAToi3XEESipRia7xV2I2buRiu6P0UebxK/6b+oGIxRmP6kswYTU/eg+rUFK7qevj44 Ei+qb/F4fhjul3xeH4Y7q3v6Utdvgbentj0PuXqPe8n0hZoogYLa0vlSWpkktrib4n4qqEhOlaUH ic850YlGPpjjyAHmYTlzoV9PyHeXr9QQTuZQ26SiPjz/ABS/VbS9vBDE1lb2b25KH6va3MTMzBTS SsZqaUI+fvktXhyZaiYQgY7emEwTy5+n8X5scGSELIlKV98onv5b/iksuNIltqfWZVg5FlX1I50q VpyArGOld8wMmiOP6zw+8THL/NcqGoEvpF/GP6068p2tlx1MT6mLS3Nt++u4ZHgeJQ4JcSuqhPnn QezMAMsqkD6fPv8AMB1XbUicYsEb+X60+0fQNHur+2vLHzVqGpDTlSOS2TUBLC7JyANwsQHJietT vTwrnZvNgebLqDxH44GbqDxH44q6g8R+OKuoPEfjirqDxH44qujA5rv3wx5oPJFZe0uxV4H9Xk8U /wCDT+ueO+EfL5j9b6Hxj8Au+ryeKf8ABp/XHwj5fMfrXjH4Bd9Xk8U/4NP64+EfL5j9a8Y/AKYa Na3TNdpDMkMzW5EctUfi3NKHjyFclGIjZmBKPUcQF7jr0dX2qbxiv53d5FMdPsNUinuJLq+W5hkK i3hAjX0+NQx5A1bl4HplGv8ABmIjFjGOQ5njG/wvp39XQwBHM2j/AEm8V/4Jf65rvAl/R/00f1s7 d6TeK/8ABL/XHwJf0f8ATR/Wtu9JvFf+CX+uPgS/o/6aP61t3pN4r/wS/wBcfAl/R/00f1raeeVU KzXZNCPQPQg9x4VzsPY/GY5cl19HeD18mnN097DtG07U7q1muNKt7r6vGwMzR3ccfxR0dSQVUkr1 GV6LTZckDLDGfCOdZAOW/cOXN6bU5scZCOQxs8vSTz270cui+ZJnLiO7eQk8j9eQtzST0CCSvUFK fIZljQ6qRushP/DRzB4e7y+TQdTgiKuNf1D3cSQ3WoJcml0bqYqSR6lwHoxoGPxRnc0Fc0+XUif1 8cvfO/8AeuwhhMfp4R7o/tTnynNpaLqTSafPewfV6TWahblpVZ1BURcF5dd/bN/7MmByy4QR6epv r7g6rtoS8MXvv3ftTe28zaZo9rcPY+UtWiRrl0dLayUyyvVi0xAapQnoxOdm80DXREN+YDoJvU8s 64TDHFL+7tOYf1QhKISy1ZOfxDtQ40ni8l9p59E97Hat5c1uEyKH9eSzIhXknOjPy2YVoRT7W2NL xeSLXzch4f7htVHqSJEK2p29RA/Jt/hVa0YnocaTxJjo+qfpK0NybK6saOyejeIIpDx/a4gt8J7Y Eg2jvh8D9+KV0dOa7d8MeaDyRWXtLsVeEWOm3l85jtY/UcFQRyVd3cIv2iOrMM8g0+lyZjUBZ27u poc/MvoGXNHGLka/Zujb3ynr9jay3dza8LeHj6riSJqciANlYn9oZl5+yNTigZzjUY894n7i0Yu0 MOSQjGW58j+pKM1rmJv5es7C6OopqE3oWK2cj3MlGNIw6cvsFW6eGbbsfSSz5SIS4JAWDXFyI6F1 HbRAwi/536C3bal+V+lST3ketmJ7xlSWU2ty3MxqGChaH7Kyjt375vtb7N5tTGMcmbaHL92Pifq6 /LueZhmjHkE1t9c8mTyyQrrLLLEkMsiNay7LcmMRGoqNzMg6981/+gj/AG3/AGH/AB9n+aHc1b67 5KubYXNvrTSws4jVhZzgc2ZUC/EBSrSLSv8AA4/6CP8Abf8AYf8AH1/NBMdPXy/qOpyaZZ6qZL2J WZ4jbSJQKELfE3FTQSp374/6Cf8Abf8AYf8AH0jUX0Tf/CS/8tZ/5F/834P9BX+3f7D/AI+y8byR +k6KNPNxIJvV5xFeJTj7/wAxzddjdgfkZTlx8fFGvpr9Ja55OIj3vN9N/RFxC73t3BZSBwqRfVpJ artVqqaDOX0xwTiTklGBvlwGXx2etzeJE1CJkP6wCMFt5W+MnV4qLXiPqMoLU8PiNK++ZQx6Pf8A ex/5VS3+1p49R/qZ/wBOEnurmGKd44FguIl+zMIiobb+Vt81mXLGMiIiMh38Nfe5sIEizYPdbIPJ N/cpNqEtrZJcXEdsWitoysRkYMKJzc8RXxOdB7NZeLLLYD09Pe6ntmFYxuTuzLR9R1e6kmS+036k karwl9QOHcswdQtFaicR8XRq7Z2bzgtNK+wwMnV9hirq+wxV1fYYq6vsMVXRn41274Y80HkisvaX Yq+fs8ZfRXYq7FWTeQpbiHUb2W2g+tTpZyNFbhgnNhJHReTbCvic6T2X/wAYl/UP+6i6ftv+5H9b 9BZDN5l/MBIw0fk0SuWI9P8ASNutAFU8ixG9SxFKfs++d3s8tcu5Vi8weeA8qzeVaqkUTRPHe2/x yME9ROLH4eHJt67098dls9ycaHfaxd2vq6rpi6XPtS3E63B96sgVcDIWmNR4YpdUeGKrgf3ctNjw O/0Yeh9yOoeU6ffPAqi8T64wcsx/SAiqpAotFfsQd/fPOtNqDAesce/+rVt3bF67Ni4vpPD/AJl/ oa1K+kuEgFin1J4wfWb9ICX1CaUNGccaUPTxx1WoMxHwx4ZHP97xX8zsuHFwk8Z4u70VX2IHnrH/ AC2/9PSf815h8Wf+f/0sH/FORWP+b/sT+pM9Gt9fu1uYYLxxMUHCSKaOVk3+1xLOPvGX4YamX03l ogmIydKPUSsdHWdqcHAKFb/zf2K8Xlz8wBKWk1aUxkEeiI02/elgefKv92eH45tMkc97abJ7/FI6 d11z3dAB/S+xMbHSfNMNssd1PNdTj7c3wx1PsqmgzU6rRdoTnePHkxx7vEMvtMmyJiBub+CI/R+v /wAs3/B/25jfyb2p3ZP9N+1lxQd+j9f/AJZv+D/tx/k3tTuyf6b9q8UHfo/X/wCWb/g/7cf5N7U7 sn+m/avFB36P1/8Alm/4P+3H+Te1O7J/pv2rxQRWl2WtJqNu0yy+kJFL1aopX55sOytB2jHU45ZB PgEhdy/axnKPCWZZ6Y4LsVeJ2Ew9U/X7mf0qLx9CaPlXmvKvNqfY5U96Z5Vp57/vZSr+jId4vme6 /jT3eWO3oEb8we79dfBHXs2h/VZfqNzqIu/h9H154DH1HLlxYN0rSmZeeen4D4csvH04pQrzujbj 4o5uIcYx8PWhK0o9bUf+Wk/8jh/zVmt48v8AO/2X7XM4Yd32Jho8mrM12sN6YZmt2EU3qCTgxdaN x5CtMsx6jJjuRJIHTxOG9x1B2db2rGPhihXq7vIoq2t/NyRhZ/MLzMAtXCRISQxJ25EUZSF+jLZ9 sRJ2hIf9bEv1vPjEe/7ETY/4ihlla71ZrpGH7tPhj4fGx6qxr8LKv0V75i6vtLJMAY+LGev74yv5 n8WzjCue/wAEb9Z1D/lpf/kb/wA3Zg/m9X/qsv8AlZ/x5lwx7nfWdQ/5aX/5G/8AN2P5vV/6rL/l Z/x5eGPc76zqH/LS/wDyN/5ux/N6v/VZf8rP+PLwx7k58sy3Ly3QmmaRfRNAX5038KnOq9lM2aeT IMkzIcHWXF195asoAqu9hWjgxoot7SK/pISGktJJiTRfg2PQdae+YmiFD0xjk364zLu2/He9RqN/ qkYbfzgPi1rYMkVqLm0i05VDem8VpJAZfs1LFj8dP44NeOIR44xxc6rGY8XL5/tXS7GXDIz98ga/ UlXoWX/LV/yTbNd4eP8An/YXL4pd32sg8o2+nsNTjk1F7WKS1KSXcbfV3iDMBzWRtlIPTOk9moxG WVG/T3ebp+2iTjFit010mw8saZdwXCecbu6UlZkhutRSaGT9061NR8QcFpOvVajYZ2bzQodWajiR UGoPQ4Gxug8cVdQeOKuoPHFXUHjiq6MDmu/fDHmg8kVl7S7FXz9njL6K7FXYqnHluzS7mvIpLhbW MWzNJcPIYgoEib8x0zYdm6TJnyGOPg4gL9e8eY57F1PbJAxC/wCd+gq9j5b0dzDHB5timZXMSIt+ G5tM3qRoQQxc8RRd+lc6PJ2Vq5GxDTdOYltt/VH4p5gSj3lktn5JvbWL01uRKNvimllkbYADdlPh mq1Xsxq80rJwx/q2P962xyAd6v8A4U1D/fsP3v8A805jf6DdV/Ox/OX/ABLLxg7/AApqH+/Yfvf/ AJpx/wBBuq/nY/nL/iV8YO/wpqH+/Yfvf/mnH/Qbqv52P5y/4lfGCZ6Ho1zYPcyTOjK8RUBC1fHu ozf+z/YWbRTnLIYkSjXpv9IDXkyCVe9gOjoskaG3vjYKZGAWS+ENGotXosWwOwr7e2aTRRBA4Z+H v1y8Pdv9P2+Xk9VqDR9UePb+Zfw5ta4qxxWpur46irBvTSO9E5ioF2YNF8Ff4Y68CIjxz8XurJxc PL+jt+xdKbMuGPB74Vf27pT6mnf74m/5HL/1SzW8WL+bL/TD/iXMqfePl+1NdE1HTrOG+kbT3vYW iCTWr8Z/UUtWgj4Ly6dM2fZmvjp53AAGXpuc6iOZ58Pk6jtiMjjF779B+1GW3mfRjbRxxeVT9WkA rG0EZEdQfgKGvHhTjxHT5Vpv59tZI8zgB/4Ydx3/AE9ejzggO4/JkkfmuQRoFtVRaDilaUFOlKbU zTT9spxJHhxNf0v2N4wrv8WTf8s6/wDBH+mR/wBGk/8AUx/pv2L4Pm7/ABZN/wAs6/8ABH+mP+jS f+pj/TfsXwfN3+LJv+Wdf+CP9Mf9Gk/9TH+m/Yvg+bv8WTf8s6/8Ef6Y/wCjSf8AqY/037F8HzRG n+ZZbi+ggMCqJHCluRNK/RmZ2f7Vzz54YzjA4pVz/YxnioHdlOd44bsVfP2eMvorsVdirIvJUsMN 1qMs9s97CljK0lpEgleVQ6VRYz9st0p3zpPZf/GJf1D/ALqLp+2/7kf1v0FPINV8t2kcGo2Xk+7V qKWa3sIRPC6KIlRlU8wyrIy0X7IBGd48rfkzZHV0VgrAMAaNsRXxBGRbG/h8D9/9mKu+HwP3/wBm Ku+HwP3/ANmKrhT05aDfgffth6H3I6j3vIdOt4p/97ZxZ/EBX6mJRxI6/Cv4Z5rpsQn/AHkuD/kn f3B7LNMx+kcX+fSzUYfQljWzkW8RkDO/1QRcXJNUoy70FN8hqYcBAxnjFf6nVHu3DLDLiB4hw7/z r+PNC8r7/fA/5EJ/zTmPeT+b/sR+ptqHf9p/Wn/lODU7hr9IILf62IK231qKkPPkBV/TCsRSvQ5v OwtNHNOUc0AY1e8Rz+TqO2CBjHCevemDaR+ZRtlAt/Lq3Jdg5CXfERkDiVJ/bBr1FOmdP/I2j/1K H+lDzvHPvVhpHn0PcD6voRQyP9VYpc8hFxf0/UoAOXLhWnavtj/I2j/1KH+lC8c+9UGkedv0mo+r 6H+igvxEpcm5LBPake8n4Y/yNo/9Sh/pQvHPvUW0j8wyg4weX1erlgY7silF9Na1HfkGb5UXH+Rt H/qUP9KF4597Kl0nT+I5WsfKm9FFK4P5G0n+pQ/0oZ8Z72/0Tp3/ACyx/wDAjH+RtJ/qUP8ASheM 96pBptjHMjpborqQVYKAQcsw9laaExKOOIkOtMZSNc0zzbNDsVeD2OoXdjN61rJ6cnw/FQH7LrIN mBH2kBzx/BqJ4ZcUDR/aD94D6DlwxyCpCx+yv0r9S1W/1OZZr2X1ZVXircVXYsW6KFHVjk9Vq8me XFkNn4Dz6e9jh08MQqAoIPMZuTnyxNqUNzdvptPrn1ZhHyBK15p9qgJpmdoM88UzKHFy34QDKrF0 Ds6rtgXiH9b9BTFtR/Nj6qSr2P1vnsDFP6Yjp8uXL8M3n8rG/wDkVX9THf8AuaeZ4T/R+1pNR/Nk W6hnsTcfDzYxTcftNyoAo/Z4096+2GXa5MtvzQH9TH+kHz+xeA/0ftVINS/NITzeubM29G+rlI5h JWvwc6rx6daZCfa0iBX5oHr6MdfD0qIn+j9qbx6n5lMa+pzElBzCpVQe9CVG2afJ2r2nxHhOTh6X AXXn6W0Riu/SXmHxk/5Fj/mnIfyt2r3z/wBIP+JTwwTXQLvVJpLlbsvxEJK8lCitfGgzo/ZzWazN OYz8VCG1xrf5BqyCIqu95/p0qwf72wJeDkCP9OWI0puvwuc0umnwf3kRP/krw/cXrM0TL6Tw/wCZ f6Eet9pHpvXTQsnBRERqIYeoD8TNVuhB6e305mDUYaP7vehX77r8/wAfa0HFkseva/8AU+jS6hpQ IJ0lGHx1B1M78mBXow+yvw+/XANTh/1Idf8ALee3XoNlOHJ/P/6V/s6rQJryS6/RhXSw8arHS5S6 KNvVvjbf5HMTU5YmQkIgY7Ho8bntL+K7cTXRIxAE3K+fDSDOhedDAqHzOPUDkvIIbYVQgfDTntSn WuMdbgEr8Af9dH7XTcEv53+xVV0fzcrzkeYEKSM5hVooT6YavEAiQcuJp165A6vCQLwixX/Ijn9q eGXf9iraaV5miu0luNd+sQLQPblbdAw9PifiVuQJf4vwplWfUY5YzGGMQkeUvHut+4y7tvtTGJvc /YmvC6/36v8AyNT/AJqzU+Hn/nj/AJWR/wCKbbDuF1/v1f8Akan/ADVj4ef+eP8AlZH/AIpbDuF1 /v1f+Rqf81Y+Hn/nj/lZH/ilsIzSEuRqlrykBX1FqPVU9/ANmy7Ghm/N47kCOIfxxP2cTDIRwlkP lmAW76tDXpfyvx329RVegqSKb12p9+euOvTrFXz9njL6K7FXYqybyFbfWtRvbcTSW5ls5E9aFuMi Vkj+JGINCPlnR+y/+MS/qH/dRdP23/cj+t+gsib8v4mtGtR5j1tXMnqtcLfH19wQF5cPseApneW8 tw+ZWW/5f2ws0t4PMmtGNOFJEvRyIUswqyp+0HofYL4Y2vD5q0HkVbaa5nHmLWeE6uvpPdgxRczW sSmOi8f2fDG14fMpnonl5dK5f7k77UGYuSb6czU5kHYUVRx4/DQdzgZAUm304pXCnpy7/sH9WHof cjqPe8o0ae+t99KmvGBcH93aJKOYG3V23pnnOhyZIf3Jyc+mMHf/AExev1MIS/vBH/TEfoXaja6p qMkct6t9I0Uaxo5slQCPkeNeLqN2J3OS1OHNnIOTxSQAP7sDbp1CMM8eMER4BZ/n9fkhU8v3DmiW 9+x+IbWZO6Hi3+7P2W2OYw7OkeUcv/Kvu5/xdG06uI5mH+n/AGIyw0vToEv11SWezgghWa4+s27R lUDAA0Vy/U+GZuh7LnkyGEZSx5I+r1Q945GXm63tXMJYgfSY30N/oSkWX5RPa3caX3OOOEXNxGLe 8UmOeSMK1W41LPJHTfb2Azf/AMma+7/M/wDSuLzvFj7vvZP5R8ueV7mC7k8vXTCIzVug0M8f710D /ZnKkVRgdtswNb7NajUkeLn4uHl6APuLbjyRHIJ9/hI/8tX/ACT/AObswv8AQUf9V/2H/HmzxvJ3 +Ej/AMtX/JP/AJux/wBBR/1X/Yf8eXxvJ3+Ej/y1f8k/+bsf9BR/1X/Yf8eXxvJ3+Ej/AMtX/JP/ AJux/wBBR/1X/Yf8eXxvJEWHlk297DP9Z5em4bjwpWnvyzL0HsmcGeGTxL4TdcP/AB5jPLYIpNNJ SQX+rs3KhuVCBmBFBBGaqB03NN/DO5cNM8VYH/yqm2/6uL/8ih/zVnIf6Eof6ofl+16D+X5fzPt/ Y7/lVNt/1cX/AORQ/wCasf8AQlD/AFQ/L9q/y/L+Z9v7Hf8AKqbb/q4v/wAih/zVj/oSh/qh+X7V /l+X8z7f2I/Svy7sbJrkTXLXMN1A1vLEVMfwuVJ+JW5D7PbNh2b2FHS5DMTMrFcvMH9Dia3tQ54c JjW981Gb8n/IE0SxS6aWjVi4X17kfEVVSdpf5Y1zecLq9u5ERflf5LinknjsOMsqQxyN60+6W5Ro hT1P2TCnzpv3x4F27mrX8rPJFrbrbwacEiRxIo9WYkMGV9mMhb7Uamld6Y8C7dyP0/yV5e07UpNT s7b0b2UMskoeQ1DBARxZivSJe230nHgSCB0Tf6sP5vwweGnjaeIJDKa1+A7fRglGgfckSsh5Jow5 gPbXUOnln4n1Lt4TVQCGPEdPi2PzzzfRbi4Sjj365DH4/a9jqTW0ome380FEajqN/p8CD9IrdLdp wdLe9klKIlCFev2ftbU98v1OpyYYj95x8Yr05DKgO/u/ta8OGGQn0cPCesAPl3/2Jf8A4ivf9+3P c/70y9WPI9+7bnMH+U598/8ATy97k/k4d0f9KE78qa4wur+/mgubyWK3Wqxl7mdx6iiiqxqaVrm+ 9n9QcuaRN8XDzMievm6rtbEMeIAcuLoKTeXzwlrDNOvlnWWH1gxFIbMNJIwFDLxD/YPGgY9c6+nn uLyVrTzu01y0Evl/V4CsccnqtasYiZFU8AwNeSl6NttQ1xpeJfY+c2vIfUXQNWt/tDjc2wjIIpSo 5sd+W23Y40vEmGna4b2+mtTpt5arEoYXNxGEic7VVGDMajl3Hy6YpBTOo8MDJ1R4YqujI5rt3wx5 oPJLfLbA3et8fSoL4j9y3Ja+lHWvg1ftD+auXtKeYqwDXfzk8vaLqFxp9za3stzbMVdYYoqMOUaB 05zISpebiDTqreGKqWn/AJ1aPf6hFYQaNq5nkuFtG/0aJhHKwJHqBJ2ZRxVjWm4VqV4mirNbnXNI tVZrnUrWBUkELtJKiASMKhDyYUYjemKr7jVdPtuX1i9t4eAjZ/UdVoJn9OImrbB3HFfE7Yq5NU09 5fSS9t2l5Mnph1LckYoy05VqrKVPuMVVY7u3lQPFcROjU4spBBqeIoQ3822KtpcRP6RSeNvWXnDQ g81oDyWh3G43GKpbqur6tY3ttFDp31y2ndYzLHKiyhmD1KxOV5KnFeR5dCT+zuqllt5p81yWFvdS +V5VMjEzCO8sZI1h/ZljkMyB+SkEAhf2vBeSqq3mrVnkVIfL91NDO6wwSiaxZCxUuxk4XL8ECCtd yenHpUKh51ggELy+Uoo4nkcXE0n6PVIY1aiMxMtS0gpRQOuxPfMP+TdN/qcP9LH9Tk/nM38+X+mK jDc6ezcJvKSxyqGEyKNMf02VC9GpcCgYKQpPcGtNiX+TdN/qcP8ASx/Uv5zN/Pl/piozatoUN2lv L5fsoysQub1Xl0xZbe3BdZJZIzN9iJ0VXYGlSaE03f5N03+pw/0sf1L+czfz5f6Yo7TtUgF5avpf l5fqF9Gxj1K2fTgrcSxCqEuOTgqgYFa9d+9LcWkxYzcIRj7gA1z1GSe0pE+8lE+Z5fO62tq3la10 +S4dyt0uolwEBZQpAiYbKORejE7DiGrl9BrspROfzpWRmit/LbxGVQkfK95iIkhizEKKgUOw+g40 FsrrUfnEL/0LiPQGs4xC5ugt0plDNSWNV5sUdVUtyK8d1/yuLQWy1En51bCVPLPRqlPr+xoeOxG/ xUJ3/rjQWyrwW/5sLvLJoTn0GqpW6p9ZEYCUIC0jMlWYmppsKV2aC2VtrF+cHo3Juv8ADvrlU+qC Jb3gG35mTlvTwp+GNBbKrokf5rpqkA1r9APpSlhcPaC7W6K8TxKBwYweVCfbGgtllyxopYqoUsas QKVPSpwobxV5RqNr/p+rXV7bQ3EzMy2Lal5ae5QoZ5YvQjmtG9WTkxWhfcqeYBBPFVfqumRXE01h FZw2BfjdQ31r5YuneCWA+tGHcmSGQqi8Pg5cmJHw9GVRAsNGt7mOG502M2jW4llX/DcosmYo/Ngq 1kSWiqvFyarxVQWJOKobUhdm6SSPSElmklVrdovLU0h+q+qkirO9zPHwb1BWgcFQORUGnFVPdO8h E2LMItJgW7SBzaHRoo1jCSmVo3jE7/stxpy+FuTA77KpxZeUrMPc/pKz0u6juAof07BYnk9NiYzM WeUPxU0Ap13FK8QqjR5W8siaCYaRZCa2VFtpPq8XKNYzyQIeNVCk1WnTFWJ+cdN1S61yS4stGtrq JYVt5dSSGG5vY5g0b24RJbiBAqPKZX5ilFFdqYqlOlwrNc3X17StK+pII4bS0+oab++kcIqcJFvm Tk7Wfwxk1FFrsoxVWnttVtjc39t5e03TobIxKYJ7DTvUCBQgYyx6mqKUjdlUNxHFqd8VQ76VciPR 7CbQ7K2vI7hoo4DpumlWSS3dZVkhTUuKiYepL8H8vGh/aVRMlrP9VnuZtI0eTT0Drb3n1SwdCkaS uYzyvIU9NEkeAfEpBBZvhZuKqjDoPmJzYQP5R00RGMi7uo7axQVkdwyCIXbrxEcrtuHDV/ZJJCrI ItE0IyC2v/JMCO4ihWeOCwaKYLAJGWgk5qiNDx4uKbLT2VTrV/MA0a0jZdJv76qO4gsIFmZAjovA gMqhv3mwB6K3hiqT235j3E07RN5T16FdjFJJaABwQh7OQrfvOjU6GpBBGKsyBqK4q7FXYq7FXYq7 FXYq8TvNM8mT+ZdRnv4tHkk53FxfT3N/qFuyCO7+rglpCYyxB4ssa8QV4fZZSFW9G8s+R5UtI44v L73syPO6Jqt+RJ+9EbSRvIeUir6MxoQaN3G7MqjZ9T8qmUm5utL1YNNb2wMetXxf0oilzEBHScXL JOHZeJr0TdiQVVYWWlWXI87Jb1eULTRa3q0o+sTujR1KLyi9WeflIWdmCHqVYkKory7N5WF3DHqW r6fFJF/vJHp2u38sYKHggk5yxxlm5HZhVjyO/wAWKslt/O3kDSbGC0j1iCO1t7eN4ecryn6uWMcb +o5dmXktAxPh4iqqZad5u8takyrYajDclpDCvptyBda7V6b9VPRgQRUMKqpF5stdLn1Mpf2VvdLR XT1PL93qbDdDJW4i5RnmkfGlAR8PWlMVSa5+qz2VzIdJhmAEzW1uvli5MytxLyD95N6bPzKtvxDk ECp+yqm+n+RdPuLMTvZ6Rcx3LLcNHdaIsDdEHH02ZHQ8RJT1FZhyHULRlUTF5JkLvPNFowupUaMy ppS8o0lRVmjRzNUq7NKfiBrz3BAIKrWm+Q1tWUzxaLKvoCJ1i0hIOTgOnPaZ9jFIUK9KVpQGmKqM n5eLKZDNHoriWSSVo/0QqoWK/uuXGcO3Fy5erfGGZdgcVV38jCTVG1CSDRJH9RDCzaQplSJCdvV+ scjJxoA/QU+xiqZav+grOyjuNVkMEdpFKRJAZ4gscY5yUWA14gRg8d+mYGqjhlkhGZInKxGjIeZ3 jXde7fizTgDw1XmAfvQX1vyJZs87ahGvF2tpXku5XCNIFYrJykYJyHE1anbxGGHZ2GJsCV+cpHnz 5lnLWZJCiR/pY/qbXVPIbIZl1iD0oIwhnW/cIkakivqCXiN+S8q/zCuxyX5HH/S2FfXP/ivt5o/N T8ud/TH9TcereRIiHGtwqXDMjPqL1ZUj9VihaXdQknM0274x0OOO44v9PP8A4pB1Uz/N/wBLH9TZ 1ryN9aaX9NQPNDySUjUGcRCEcn9QCUrGF4/EWp4Hc7y/Jw4uL1X/AFpfr/tR+YlVbV/Vj+pV0e+8 p6/E82l3hu0DOplSadS1RxYqxZSy70quwIp1GydHjPf/AKaXX4/j4KNTMd3yH6k5tbKG2BEbStX/ AH7NLL1p09Rn8MsxYI4+XF8ZSl95LDJlMudfAAfcFfLmtif/ACtj8uP+pgtP+DP9Mh4gdp/Ius/1 OTHrXX/yYtbyW9ttZggu55ZZ55o726VnknMbS1o3RjCnwjYUoNiaviBf5F1n+pyXf4l/KHiV/wAR OSVZGc6tqJcqxBKl/V5EVG2+29Opx8QL/Ius/wBTkqHzX+UZVV/xAFCOXj46nfKUJXjxQrICiU/Y X4fbHxAv8i6z/U5JtD+af5cwxiNPMFqVHQvO8jb7/acM344+IF/kXWf6nJtPzU/LdCxTXLFS55OV cjk1AKmi7mgx8QL/ACLrP9Tku/5Wz+Xn/V/sv+Rh/wCacfEC/wAi6z/U5O/5Wz+Xn/V/sv8AkYf+ acfEC/yLrP8AU5JPqPm38o7++bUJNcgh1BkELXltdzwS+kJEkMfKMqQrGJQadq+OPiBf5F1n+pyU F8w/lAskjjzGx9YMJgdUvmLlgFBZzIX+AD4PiovUUO+PiBf5F1n+pyXx+avyqSSF/wDFMnGAEJEN TvEj3k5iqRsikL9kClOO2PiBf5F1n+pyUJdY/JOW6a6k1lGuHcSs/wCkr77almUgCSg4tIzLToSS N8fEC/yLrP8AU5J/B+aX5cQJwTzBakVrV55JDv7uGOPiBf5F1n+pyVP+Vs/l5/1f7L/kYf8AmnHx Av8AIus/1OTv+Vs/l5/1f7L/AJGH/mnHxAv8i6z/AFOSX6p5/wDy7v2tpE84fo+e1d3R7OcBWDqV KyxypJFIN6jkhodxTHxAv8i6z/U5IMedPJjQvDcfmE88bGSnNNPqUdFUK/8AonFuDgutFHWjcgMf EC/yLrP9TkuXzr5JF365/MOdkDSMtuWsvTHqAim1oGITlVQzHoMfEC/yLrP9TkjtH/MnyJY2foXf nGLU5eRIuLgxI/HoFpDHGvbqRWv3B8QL/Ius/wBTkjJPzT/LSWNo5desnjYUZGaoI9wRj4gX+RdZ /qcl3/K2Py4/6mC0/wCDP9MfEC/yLrP9Tk7/AJWx+XH/AFMFp/wZ/pj4gX+RdZ/qckTp35j+RtSv YbGx1q2uLu4bhDCjEszdaDbHjDXl7K1OOJlKEhEdXxdlb6+7FWUeU/MflSws5LHX9ATVYJJTM06y elNQR/BGHUCRR6iipVwKM1VY8aB1mt0mechLFk4CBVcxz3Pdy8ug3G9i4/NX5cAfvPIwY8ifh1S7 UcfVLAbhv91/AT9O2FrOi1nTUf8ASuPd+vf7FRPOH5dpFPEnkZeM8KRFm1Kd2V1LMZEZkJUs3H7P YU6McWJ0GrJB/Mcjf0D5c/f9/RUuPNf5WLdEW3kYy2qsArS6ndJI6gMKlVLhCxIOxNKYsY6LXcO+ oqXljivbzf8Aleuj/V4vJBF5Mx9dmv5iF4R8Y3SUhn3d2ZkAUbDduygaHW+JZz+kcvQO/exy5cjv 15dUh51/L/8Aa8jxEtFHBJ/p0gqkfo1K0iHF29FquPj+M1OCmX8n6r/lIPMn6B1vz5b8uW3Jcvmn 8qTZycvJDpeLxEIGpXLI4KFWLtVSnFqMAFavTbuUHRa7iH7/ANP9SP4PdzHxQtv5p/L9ZkNz5MFx DHGsaxDUZ4jUSTOzs6IGYt6qLv0CDxxDbLRaqts9G/5gPSPn5H/TIpvOn5bSJAs3kJCYE9MNHqU8 XJQ3IF+EY5NSo5Hff2FENQ7P1gJrUc/6ET+nl5Ie183eRVsxbXvk1boRCUWzrfPA6CSWSRS7xRB5 WVHRKyMR8HwhakYhsnodVxXHPw3V+i+gHU0Op2rnvdBubzV+Wz09PyN6QAcGmq3RqWBCH4lP2Ovv iUR0WsHPUX/yTi6bzV+WzQBIvI3pyiVHMv6VumrEsodo+PGnxRgx8u32uuKx0WsvfUbV/qcedc/n v9ild+Zvy8ltZYrfyWbedwwjuP0ncOUJhKKeJTieMn7zf/V6YsoaTViQJz2O7w49/v7tvtTO382/ lGgCyeR5OMqP6/8AuQnZkYOzxpGSRVSBGpf4WHxbN3XHlodeeWcbcvRHu3v7dtxy5dC2381eRILu OVfJqvB6MkU9vJfzPzZxEFdWKVRlMch+H+f/ACRgciWi1RjXj72CDwDz2578x/pfMqkfmn8tVh4P 5GLyUAMv6VuQf7sKSBwp9v4/w6YWJ0Wsv/GP+lce/wB/wRFn558gQWP1WXyLDOVnlnima9k5gPKz RxsxjLOscfBKE0PGpHxEY7MMnZ2qlLiGoI2A+kd2557Emz8fJLPMvmPyZqlgsemeV/0PfIsKLdxX ryqREpVucLRqrGQEEtXlUVqfiquTpNJqMcrnl8SO+3DXPzvp8vsqLYuydirL/wAov/JlaB/zE/8A GjYHU9u/4nk/qv8A/9k= uuid:8d52bdd0-51c2-421a-b277-4f8e46044eb8 xmp.did:f754b842-0898-4a43-9e0c-c455130dcbcd uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:8c65ca57-e9d1-2c4f-ac6f-f08fecb72c47 xmp.did:8c65ca57-e9d1-2c4f-ac6f-f08fecb72c47 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:7FA3129E7E0DE211A8B9F436A6A79C5C 2012-10-03T14:20:24-03:00 Adobe Illustrator CS5 / saved xmp.iid:f754b842-0898-4a43-9e0c-c455130dcbcd 2017-08-25T16:00:12-03:00 Adobe Illustrator CC 2015 (Windows) / EmbedByReference \\hpfile\ihp$\Ger_Suporte a Cliente\Marketing\Comunicação Interna 2014\Apoio aos setores\Cartaz Vacina\mulher.png \\hpfile\ihp$\Ger_Suporte a Cliente\Marketing\Comunicação Interna 2014\Apoio aos setores\Cartaz Vacina\mulher.png Print False True 1 296.999942 419.999828 Millimeters MyriadPro-Regular Myriad Pro Regular Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-Regular.otf MyriadPro-It Myriad Pro Italic Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-It.otf MyriadPro-Semibold Myriad Pro Semibold Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-Semibold.otf MyriadPro-SemiboldIt Myriad Pro Semibold Italic Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-SemiboldIt.otf MyriadPro-Bold Myriad Pro Bold Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-Bold.otf Cyan Magenta Yellow Black PANTONE 442 C PANTONE 446 C PANTONE 200 C Grupo de amostras padrão 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 200 C SPOT 100.000000 CMYK 0.000000 100.000000 63.000500 11.999500 PANTONE 192 C SPOT 100.000000 CMYK 0.000000 100.000000 67.999297 0.000000 PANTONE 201 C SPOT 100.000000 CMYK 0.000000 100.000000 63.000500 28.999299 PANTONE 446 C SPOT 100.000000 CMYK 21.000700 0.000000 22.999600 75.000000 PANTONE 442 C SPOT 100.000000 CMYK 8.000200 0.000000 8.999600 19.000199 Grays 0 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 0 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-1:2001 PDF/X-1:2001 PDF/X-1a:2001 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/TrimBox[0.0 0.0 841.89 1190.55]/Type/Page>> endobj 7 0 obj <>stream HWn$WsdUa>AcDife 0엕K/"nљxcNǗq9LK޶nRD~ _pY;KWsׇ?w7_\QRctz5M5XydNjSsi֢\I06׿}t~;1{#D`ckn^u,#1Spw}\WJR2r߈ټNwG",OKܛ{&N˷Wcӝ:)-sg He17[ϴlLfx #\ŅlkΆez ՛}950}6wXpXy (mY'ayĎ'#=oaϯ(V!g-l-Ufm9T§qWe7| 06|_Z] WeE7ƞ؛%tuL)اd].C|~EWd`@0NG tAN"4/RSր5-Zc0X0x/^늭sUmgz9MPhj했A "STWRat) C !M͸KP֭NABtX.X;ABԕu%ȼYͺ@<^W nPv"78"hXvXlZ@vFgh8:rXV__?DuvBpv5 !!c8,&dgpQYSYN(i'ʴ\=1ourA†@M(ls azD7 ҹ%F ! 9m1O Jlz~XMy ہ*yD _p ]"O+V*e$B:+1h-ˍ5h3iFى\%'R= e1>qŽf&F ǫˏa9{X y BϵN}4uRIr!-#:4d,(  eAdvz*J* rǯ{`%@w2FX#"Љ f(9d?Ԟ|D 1U%)j;%Q1,0#VТDyd+˅"y {{Ōj;Kw%KL;2v C؏9I:NF/!ANIc`I %qk }b:{Oo$1k u8|zWolasN3` Y.V%T!FBGUI$zVLãP#2 Og4S^\ fQfiϲE6< q {<[MO WcB&TXQTUV"Q%B8@Q%2zo1IGZ /.KĐEJv=;@q[ڔ9dt!8 CӟKXXHY蓬yџOb(fHZ&%DPHA)`mgY^M?1BPhAH L2ASVwɂ޺4MXoS|nLaF,K]aP(m@R:tdAuDfԶ ťe1LY `X64l6$hyG,#SqQ;POkAa6z14qj}ZO%`H!fOC cU]Te`Yt(K.LYX)09|>Lp1,MN_a`m|󽴎: l/'+ܷc,?KsjQ(5e-E8d&Kn:D_#t .};GgE mQ4z"A|7bi;bHsP8-6a56~oT? l8xr"+cRO8DDE{ш<1.EMDӤgےK1.9ȁ,#c9t&-$8ZA0pv]myFi̹sE9OXPV k>MHNz0+^qVa3褡xu]9_.D1%ġyޤ>yjQCES2E|ܐ-%;͛U휵+9&^ª | ِx-[ѭMnwdfwoVJK;%2n#t@yٸ(1hA]r*-9fBAQ̀߅;+JQE e sf]BJ4c%\{]gZm3]>"?#2]Lk[,ރP(>gvIFi9&)]%q.M'ՈҙJ )rm(@by{m/:$b4)Ux8ՉAEnwA`V ^&N^\r/3bCriMfUfnI2$WIP?Jz*m wl#3|eXDRg CVXбyssw||;2_mq7_13Qc)%ea0ZҼȩ|}1W./TA؃Ff}ZŢlME+N/*Ŧjw_mnWu-ϵW_VE(_}*^@,;y6كjX6ߧ鱖CDԑAdGOձÓgo* nvyo WX]?͹68.tV ua<_~Y^՛*P.+dܼZt y{Ў zk JwN pmkdH6zJv ҹN^ֲM2F"*θ>5sb$s3ҨI<˶~ +mfVnj`dS32*#3+#&-q91&˳G*:H׃՛]ǥkU XD<|yR ^?s~+ߵzDd{=>%/D'L\x\ytnItsR7#҃Zdn6Ţ"[~\48]/חt\;X.ś-F! S T[*TC"= FWn o@ ̟}G=5n/u6ԊA5CH$M҄497.-97mzg8"E %PДB@^"ݣ^?W t,U #pHr Yͬ7L1cac̰ 1>^u&UBh֛E|GQ=YCqVa+sM&;3;is=R0}~4JyU az)^g"b5[ݓ'"w ĔfLp7 –RLeOA淄-ZDϻPeލVw܎ }9 yyɄ9\/4_j'WaHDebSKo!sWPM6^Z9pUC'y^HrZ?~8Z*BzH?/8̠IEhHSR0)8vKLÖ+"J ^X <0˯5Ȋ`.;@u}aOgwT1SOyj|"HOt"¬q04On*Wj7JqgfvTDi5}1# NC3Wc%j*a.Z)H'oO,=`]a}3hgbনAdը-au[ºIS+ON_4mrl0`|l<DZwpFg1 ƌ\1UN1FL&o5D=$Ł};e;yT6ED´5mKT}b {\Neq\>ڹ.?,siuNҏ |w -s3즢  rFhDJvvٳ.Ϙ..6yYsZ&bkחKI !WP=G5F10;fA!wUc:1NA>W i.Ww)UCt㖁(d_)MH [8T2 LގhQ[ba} YhYx1¹)sV\8vLL^A\h竣%qh;@N("+\; QeSR(ѫWxk(..Ra%ɨH""󛦚kkoXq&ƠlPh7$;A"v&[&+@#Y,z&۠-iL첌˲ hY4 T71h؄Z~mobP  rgbt6ְ SBe);-()|1 ˚e՛40CٱIM;# 5|m'k~ch4lCdd CH:tk:^^XV,k74ن9 :2@6, Xәko Ơa!8-6+Ɨ VՃcl(6ȡ71h؄F%Rl]@6a7+Zò}5jI6,{`!Bd# 0{ v9+4e%HPY?YtY6{5lB|-u$^ދ3SQΆY}4Fku N xbgct6 bol#V_m㈾+x4ˣl9Jl,+)ئ %Ѵ?ggvW DQ|U*پM_H(hdLb'!=?M_=&D87H(٥X-|1ABb7 )M0*Hr+L]& V>.U>Sd#>IJa7gN =JVL(#M '#5 T14 "#oDRyV*mD8Hqg!:..eG -..Vb0A`#sҶr(] UQtD8*`2''#Lb_zR4#:M:OZVq5m>"A#Zg`:`tFGIm!D89t#-#A!Т#K$%=U+S9HuExFjElK"sf24N R$sdhjh2=4Y\StD89,A -۸69 5ˢ]"#&9H%Wde[&866N 7)4EESd!}*ԧ;GGdn6+('렯 `|-q~Fm@1o9kLYwZ<8dLNn<:@?>'.AIjka>c8'1rvQrߌ5%0]qnd;@$3 ZԝP"S{pKBl [O[rrWCDmÃDB-]XꩨL s|JS CI^q:3tBw@Uo7ÿץC/~) oS#t,S^َ5u=N^kJ>Z2F! (Dm #@V8ʡ }k7֮ )H.s9{ ac2XPId||s`V_1}lš<Ժ5HL l[0D) 2qKla@DV6 )mćk阕t`?'C*Ŝoa΋cIU/3e$Q r\]"cGZF((H FcZ,Z]P?[2z`gwYx:h]J(K*%T.(/҃I~LL%PPgC^g cvaMa2[.C1][ÍԳzu݂΁UtJ `qiT*SIT^h-~Ńw[#V%dN `#M-$t)QH[n$ %әEc[N\/*FnӠ4FbF-202jZ[ `P$TwQoϓ!_zW].Ȃ+G=­F>7W vU&2wnq~~b"I@#4 -!͟e);f8@Bpq͐tsa[ H؎y GJ^˔Ȝ#2Csm6fcªMݿG endstream endobj 17 0 obj <>stream Adobed                       S5     m!1A"Qqa#$2Bb %&'(RSr)*3456789:CDEFGHIJTUVWXYZcdefghijstuvwxyz{!1AQaq"2BR# br$%&'()*3456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz? @ @ @ @ @ @ @ @ @ @ @п @ @ @ @ @ @ @ @ @ @ @ѿ @ @ @ @ @ jMx Űc|kflwKsf=mvERܝAZ @ @ @ @ @ҿ @ @ @ @ bX~I-~)[E=s l梮tڌSmI]e8E\Mf?7im<.p<5`׾p[~#=gym,TT߄w[[C<8dϲS@3;'A͌x֑7%hbqxwZ&~M쿒k=I[Q}9%,r|F~~1QjCT";SL~ifrN.ۚ/Cs5M؜,`2y\=kۘ_K{u*- rƇ+=+1RJxڋ/ג]4nCn;#,UA]],.cfyc ѷ -eJrwV[^SܶWr{ hR7JOwwŕ/i2%y6'-\jjo =A.%L?:4+boi>f,pi\8ȉ@ @ @ @ @ӿ @ @ @ @dN'c.:K5yIDǵqs w_uqXIsM쭓WS%5wfwemdg 싊RI5-3OML^Xڱp7qaԫ:F*S32 >̢F2=Y٧vڹZJ|J哒{k9C~$J.v3V̒ȭi59k!ܤ۵}<+&χqYūY\}E#Z[U#lz*ujI;~ѣ n'4;Z.\ѭ8t:[:}oW̷'r{$5Ϊ7-niV\ѕ[rVXn.KGjjVxnb6sapG4ԮadZ .WjG֌h$ :K[#i|=A,D[uO3e"U;%j'~^U-D۶u2v̞4AΜ՗^#kdcKܐlʔ7ۈb%(87 p2?7lK +럴.rL:S!Nba]6Е.FpVJ<'3,&ԼAars+ZK^VgKF'x%4He]3e Xl\++dzJTݤ|;쪮&./[=化tuٞ'@ @ @ @ @Կ @ @ @ @6~ฎ;Hc`tbk sIUA]}l6U|Kן| òEvm(QU b:Oś`ro: * FO2NaC*tZ6VvAgyɘdlN=)_tgxhQܺ7܇d-[L %s븀m8 N參NwrЦ8gjQ~Zܾ{os9PR|ČT{[TDچ4MN.jInUեG7Ag=[bV&K˒K73!X鐐 @ @ @ @ ?տ @ @ @ @kJڼ?bpz |=Ƨ\s:R$nH& 5q9nFWfнsrjOY+%m|i]We&Y9(1.B_t|wۏ_{J/W=p,o8hK%J=GFOSmTʼ9fzM;}Z\] 4, [qz.ODmr\HF5+"]ݺoslLkIlp6M$wV͊IqW"x2I#v2JLRa(*=X9p)OB 晴#B^͌_N+-=SC\#A,,M޸f͓=㹌m:i_7z+[^"!N8 -h.8 tZrR6$8U(wdI|e~N0P||5wa(ܷw bΊUY7C/w{l.NI9R86v4ky3k%SŽ^i./~(_cHZyH%eR:5[$;ז9ْ{vuŇGqt {,&ZZ[5șE4sNM _hv!R޽ +O^[G~W=egq*~~2*?i+ZY˰ڈ,.em/C:Z^OkwmvG!1ye%{}?#aOhmU7(u1~cXYb,$gSbN4 \tw#$|櫎Le9h⤛]q٥GvY[V= Y6:7NP3J8h?fJYVڽwkzjG4] ))n:8ޛ8MqZwo_¢y L܎هwA3CA^/2e.b&b4n` %"\oMeٌYۉbtK*vUzG+* qm$qz2i5\OZzyLE,Go/W7*Z)ԣ+N^ߦij y/ɻB=aWvfO]  F| fZk.~xO FF\Zfil.T6SZK#0sSeϖN8UFN4UdkuʖdTGp `4s_]Q¤]9h޶ӊz}_d|Ca6 L.W )O'<Faphu g*3Sݜ#35/3cJ̹Ee6-6mf =m&Rښ B0 x)R]ZNem \YP.?^Cٗ9t @ @ @ @׿ @ @ @ @e-&3hc .6jLZH~ Sib;Lttgv}>Q{=oqUʠo|nR,{t>6_wȮF{ۻ7 T##}qղQ$y57sG G;kΣ;y7]ߴ0MC芧XZ 6:h1S^ n߯!4y|N[}{iXx)m,m9]Xxw[MXWV Yٲvo+G/}#`&χ:ۻwMsjXP5'(\Wz e-\#^mɵnN-9jF8!۲Ӻܥ,-ۯC⮡aIpkm֔UUX}K5G,+Gjy67%L|A,`#:}C3&RFv[,friǙ͆HI7-x-V8 Ǽm39cQqNL崃x>6u-3$d׎{u{I)=|LrJ{-6tDz=}jJ]?Z_<ԒKklR94!ً.i=?Yrpn:xOڲvviu]J>Kupy;03d3V[i:ג׎kp'Fx<\ª޼˸icԥKçZ*}STČ+ @ @ @ @ п @ @ @ @|N{wn [);E~F;8MYPKgدi))+}\XuF5W>'Q3&H>w:E˯umg%,D=ɧGYaȣM=dZW8DGiĭ8߯qIgk}V]](ra z4ի#oMԪ{./8%grn'ʴ.{/ ~?9HkW^ \z{M3&c[ EYsȱ#x.ZsNru'ikūjܯ}D.3p2߶|KZ!U~ zEv]%lNM5=d'4 I$wR6+Sļ]:igm^~IWs읁H+M1Hyl7iw_)9JpRV1~e{-tZ1ʦH*Cw$È[atq4glqO*/ _Ia°>Hc<$t5X'}ьa6qjw]rzZ*WAk=H˺n۸j-_TPOO_iPzu ےx4~q5_FǷi$}P6ۣF*$u|WF Aqw Q(iU[GMZO[6Mm LckY`5~Q`r߾V=kedQPRׄn]ݬֵު)6xB"pп'I[{ jm]drE-ۖ(~Yakg^}N܅td︑NKXimG=J Mˀ.k onӑǒ?hϿ.=R6h~/jYbmb9熝perws!n.2zȴrХ$^#rK{8!]|Ē8[w%)$B,S xh+FW\h{,vlN\n <䩞>|ؗ<6Jgp61X3i$֓UWKwtΖ\m۩-:jP;^[IG8Hu\n66OKN݋Au+iOy3\OZ~[]OapWxf.ܶNsxV9WGL̷s52ݯiޚ?j`ҍkʔ^5u(yaM,ۈ#ʦI5ٝ*}N1=Z6?QX $󃭣,$]Գ69._)MI.ni8n=;G5êwG:M#49:6ީ*atR\IU!nY3~[)ܺds[)<:b3}J (.yp#x3$ׄZ9jǑ~Vcu3pOj¸n$j`SJ{iuV)*C=$ׂ1th5[CREJۊQݪʥÊ.c]n>mvz6 dn46b;(˛^%ژ':/ɭy/Z@ @ @ @ ?ӿ @ @ @ @ %dmp=|J_/7;"$vF[kdPs],1͕牨1ou--uZVYd䲒z+̒}:TN:թgk)n^4Lk,sfck(<:fSK& 8TiJy<^˚Vv-\L1 7ߵ-PԆ |,'~f,^:j@+F[1|bG}Y+|_x*؇h=me)7|7^GI Cl}1нk;cC o8^ˬGg*{0M5Οe&%JK;Pe.( 3,-֧l0uU%mྫྷp0dGST-o^aJt*`z4̯Ɵ|4'Q[يqؔjW)Y6޳i;$[H.Wrp0e1$h\;l$p4)ɦ%^-^ _/ml}[՜$ g9n5=>bG5*pӯ.nz|1se٣ۼLahxNҌcRr9"}3f)[1!ѭ69[ě[it|ݾuj;tk}SM@6VX,.E*R 11>p\7UehԾ1.ɱ&ipj4w#(-OKrbwgq@;,.m{k#N7F'.}ܞ1O׃]wcc/$Q0]ht[jJRd[GBUSm˭"In`Xѐ ]HwەN7zf1axoU{Dݳ%nN7sMMi>V~$j'NAq;qegnS+%.dsTTܻ$h.t LmQ"met4 Iwu洀/lQHC=*IOf,Xt]l+#q55fG,d1_-kiYjz\ ziL+G8qJKI=ԹPxs0<8zVP]pӼZQ؅K;7muQԺ)RvibO.ͻ#XXY{{ .HrLl*r>9Q`̏.l8-)iR=.\Fzl U-x.#pYUn6F{A8ދߚ.+UF'Pc G#TrC6WVUδ#p% ,Vq^6ޯmmT[ , %na]A{p/+zhӋO]A61=ZB<%M\5%ɆxF-LdNpnCu*fdRV}hX\FX9r( t!qvof?.41J(jKZnS5^.T=He\J7NN/k9@ @ @ @ ֿ @ @ @ >J|i;E+X(aw̮ǧ*7b~7׻ܒt<ݭGҷ~Q!-{JVW]}VO#'1!󴶖mw+#zQe+ڵwg `u \h85aU7˥ivۗg'Y l, ;jvFu1Rn[{ <c hN+I <[3KM=*{@ɝM6=MŮoޱu*3#ewOM)ԛ謗8>bu_/!g+#16S?A<~>%DVs VW>J^֑}E 6g[-rݝv ͬo{#(?E·jĆԟ&<)@ bOum7&puqHbϱ&i.oӫzUGzv)M;U0 fqiՙRЙ "|551 Í͍vHm 9p;F5;>.58i5C[-+@c\6MS OEڸObh9BRRQiWZ&$Z8~2(D^mkj['G%sn"9N^rT{&OٵK} ^RZ[˃Fyݽ3&eo_)5]Q|Xk=ݥy qa߷R8G6O"|i(SZOזK+o[L5𘲇cppgxV2xtj)ڸKq]|lU?" sajp9*4;32f-Foܤ;h8?BwlQS2^S6Tx][3ld3(|Đ @ @ @ @׿ @ @ @ Ks&3a :7#{pkIzy"C!B'׈'Εz=qڇy]9wV~Ѹ]ZZ+TyQ'p>^ SQqjW-.x4e4d8c/mw뼁wwJ:\:^}u#ȥugi} (мڕႡz'7oպ{]Q3!KK=/+zV7nM$ke%Uk\FѴubS9 =Wmc{Qa!qz<$vBFI\oYv62ӕVGlَI51k-nܟQ桭sØa뵺RCxl"414tqelVdyHkY)M3qѭ,:nԃ|tI__B.כ+-UK! ,,;\RQ&ٸ/uMk~'uÃȩOA7i6eQo;]<fR(M,ܼS1|{E&*G*R=It~c@v5\S^í)R#^򟚦UpjQm+熥6SR*x0@ @ @ @ ?п @ @ @ $;qI\I], 乤tP,Ti>{2R]'~f;*]Ay;'vb&#\K#OI"tZ.n^l"B9Uw'Ը)g75=wqnV| &̓i֨[oPC/<\t {YTxB~r$Bgy׊#&[%+oRe]9)r8K7>7~FfP2Xαԩ;5;fWYjGl~ N(񨵭~;65[WlbMr>P9cCoYva*v}6BuΫ9$N޹~~:?.ssk I Z 6m֌܁N s@-lym{Xu#,1jPOMDل)Xmc t]+3]{ⵔ)Xf7Z:iyFX~pǧI?vv,GgmBU,o-%Tut>*Y37^ fIՏZƀ @ @ @ @ѿ @ @ @ ={jx-1)%lN˾5p]|ULlNNȋq# xNU2<OiAh+ɲaRJ}G^b=K%wV:3MYo< 8 zWrڝzqs18nDu՟WF4<#\vKVBُۘBH? }Yczyx1H$5dhǁk'sJ7r,߅MW-FBL0e^:.28zWF lxҌw3Zv]Kt63IN*b븛_y6[;_.1'D4Vnܚ[CT8FLjuU3jvkvqwW9}0 T)yYH7.;Pɷs*BpM&ct-lNѲpc!f}ܞЕ\7|%k{qe$gW͖ަ+%Q^66fw(F7睛5˿z=3o>[`#wk0rܷ z©ʛPMsٴcsy9]xwspVfOPO4z= G-N{oЁRTۥSW@1ԧOn-. M&͉{}. FJtX~Vok_hU@d/(f]hkI&TeRCqTfgŻs𘪔_ίxf}Ud@ @ @ @ҿ @ @ @ > e2dL% !Ϟm  2["Y%뾏">syAuz oI_•#i մuWdRʁK<=1m2X㨮{T"zB*-ٟbw &&hȀ28kp7ۧeo)iF60%gjzt_[gƺZ "Bo\VB.rDZ8l+^zl{V9P4#UӊF6tѹT^E2e0xkOGVtg#Mg'{}: fw,Gisuˉ#t}ߔwsQRGq^UF -k=㿾\bkKm6~dҺ>N >%ݎh#_Q|x>m\Pb<9hyj@kz lhɺn0`-]ptw7m-ѪvP˴UՍFm+e̾\wj\6 a}GͱNҒ :myNfu,eOG6ixL<[xsKcD-z =6bi)˓G^aǰIN鱊.C\O|WvScg:R咻{g#kd&74Mɱ;])sejw='ާz4N/KwpٴE_r੣^S~BQŨ/)k[.]krRӴ K_8+H:~)mOsTFS>[ Kqú;AYtz50ukJSMKvGMzld<}xK{'NQoМG< y=f 58I-٣ғ{LBKD]/Yf4鑓D4ݫV.uZvhz_P,j4vTX()s42lQ޸q5*b<6*]%hU'eni;Vzٜ{$l,Lt,L:X7\rG4+02YaY&ی]DxfV>y29PAs\lc~6)NjtyҲofVI*C[ao_yk|fE:IIPNW~3֡V "3xڣ/z'eNQ[y<8(#F<6x3_Xry }NI8G#eCK)Hp|IQ=ϐIJRMylsY@ZF.o./KGbAdOYE *5`|5 -e[|T6SI>F|4x3ET%zUǶF57kp#]Z @ @ @ ?Կ @ @ @ nic)gb{֋ lev)1cb{Qrvj84f;th<[O-3ػɨk/__aX:K>n)b G$'wyO;Kga\iV~ͻKW#>7ГzNK$ׇ/=;keE;-dTvd4%$Ymwpwu>؎ QM冷{k/|^ekHA;'^[ww{]aq˻s\;>Sa..i.ate]kZOٺ9ei۫k I4u+R9 |$z佇pj1Һằnw:S |gym'ATnſ]q|YC]cfI vqU{6JUcMf'r^lrNS:<-Y$\Ω|XN+IQ[7+[3?5ŶMBQUg;Ts4n-C 0ԱQTTei3U6]7WaC nRG?*%Tcw8wWW*ҩ=/~Wf5Rrz/j`%٪9Rti5!,H%UX𶳱%58DihY@ۑp5{-थi.:yfώ9+'q.\X74ԋuf{+J3,dR/fcvї{S˕[sgo_ƢabyAwfmdu[k׍5oOeۭʡB07 5QQԂ{prN`-}:\Ng 3hRjYy.ӿyOv<]m+#d3duX-V(szgWY^KÜ=UNLiyZg:7w`x۳MYJ-;>:f@ @ @ @ տ @ @ @ m 7e1Yqd14IX{cz疛9)+F#{"3KU7C GFrP8Z /4ɭ%h$<6deV/r\š%z}*Q un/3<:DPcc/4a+9Qv[~?!ٛ \nݭe5|w[S(+k'dotlݮI&L5LLJbkv*Sb' cu-ל4c/F)>p|?汶%)TYdiE $6^\ 7sR0uM2K6ԩ֋揈_uo|,\k)ѩ MEO|B~#^I@oHs]z[Ά6wmZz~S78ل>[vb7 ڧ7ͅ]Ho(H=qgRWkB~V}*ɼH u޲UV2xWx#[vIƯoJb-Kne~R10+O5~+ߑk{ C>xm};~@ 9k7 :&Ѥ7n%vwYԂݙ2gy@ @ @ @ֿ @ @ @ ƻ6P,c a_42ob-X+S]7Gg sN{u'(ak^M +fӊ>%'#$RQQKfj\JC b̒C[aljSb*|D}6<+ԔƛQW9NRׇr-=>iHmzj[7QPv(elx\cf9\XcA=岤/#M{]m(RQWIh=pj[?0>n6KJYMuJOTq{=Vj-q&0؜ֹͯ>T;{<̌M #tGO@tNޫF9hxraԲonP6άbhm[ѱ[C`ƌA޲k⪚ØhMG 7o]z4.76is\I\}KNpzH=^,/,.Z+;~3Lm>yl7G(ix,wͿz~voԦ6i{Aq Җes}r @ @ @ ?׿ @ @ @ .y#16*)3kdXHd{@niFOf:&{aP;[Gcwd{mv[|)izR<܎ eJ7+}${cb?_)h8e]]V;Lc-ƹўvJ8q8URͫj2/T'Jy1nW;=:~9⶧jNGӭ^+\j'unjOTat<4q;7$ou9pwF;b36iF74ۚMr 0h0i4B\hQq/!uWkIݫwseײp0W><Ū__N]Vl0 @ @ @ ?п @ @ @ &ݨONq2I3{nkU ۵Vˑ=J7?'=`OmMk{П5rcyt8IikXBϵ8e8Zu]in/.`A&"s5ݡgK h`1՟O;JIYwx'WIr0٤nR70ߕX d[ڴq\lqKNÖ+MpO^v"SB~mCzf#'up`Z˯yu>0)6;Uosrؖٔ׌՞I+t.x31RGSN$BA#Qw`άՙ*oHÈӫݜ8P(#~ݥ|W  Y&2әUR7Sicq/ٮ/ҸYصO[Qֶ[Szn>ÁDh\b~\T#FTbxS%~ ,8 vnrcQD{귛&lrm'"*춶vN\Ыcw)qZyQC.–m XV5Ǽ+F&bRѽRt])F%g%H@4v\z?_l;wBȖ3-{u0/q@kc^=qЖe+xVK ib3~5q@c|*s\/PGS0-'\;[9,*ltZs.k|+<]7Fy^fZK3NirĥSݙ&k#sg2H7Eơu+J6{lXhe $e{j>[m:ZMC*!wGR2 3 6&MKKMt:輺cφ{~(T[F|˨vic9J[ٙQ\n BЪE3ՈV9%h @ @ @ѿ @ @ @ M fwK16I!uxJLMJ(IԒKN;E[mV#[42x70B\ִ l4![n(A%{;JlT7ڣwr.ueoM tuQ۽}S šQqJiS]W1 a֒+v[nt:iܦ;`!Q9xϣz|?]]!D;XiՅ@;g=N7i+[V[v81}+uѩwZSO6Kcum6.b`{sI:t;எ| lf=/me(fK=G1,u( 6p ֻ0:v9bيNIA 4|sEkTyr6(TXQgci{޵RQʬr5:Vӈek@[@;[::jp_N⹍ҵ`UWJzy4UeD7`^o\H6mtqً:-N>}>x4uLs x M;o:[31?.;RviC=v,ksMmcpIܽɊŋTnKKN.Bm}Ay-Nh$1@:Xtsߓ1̖mgl1qIT8U6 /xpՂT1F8*kv`FXCNYJցӔRː`l5RR| Eis9C:׶=GJo}>/"-u)BW6@[}ݧlbGGhoD︊ *Ka{&9J汇rs05t5Ɯ;Rq~H96X;XZ1#Q__Ķe9s<>-wwV!czF | eJz5[htvR*K{}|_xϽv&$վHy93 5g*-i)":wo^S6ӻ\]lwJnqK}'y([2Z蚺B m1d{*!imDRxd s~'qVVbt2|϶Tu2SIŭ-&c2EHN@ @ @ @ҿ @ @ @ MJѻ`gF&vBrz C:;J%.s5s&lIc*Ɣ/mnWj;ޜWG3/ 趆XBG/b{STK_v2]EWXk8o=Yq7eP?;*rg JڸDg,~f\4BRbhqI`2.6|٢Kxpɠl޹-|п9a%J|o{k_yxB*"hdXhiv`=whGO[\_~ZY:1ڛn.jZLn+rkz HIN-6-Bv3\NmDqJ0\S-)#cű' 9a'Z=,3op]3vZXfJWQSKd{f\vG Wy>rӨҿc0_d$ u6_$:z(i/%;-Iu9} R뤗Э=MK^K.\:0@wz9׈X[fFҺٺ<]c7Xq9`_}rӇH / $ե֍bfEvMh%Nw= Ĉ7C3`\ew6OYs`:uܕNrkѐ=')+Wtec~`lX!\]Q{? SN:AEy4mv/FڤܑT V0FqUS ;aJpH`;9N Z4evMЀ @ :\%:K.V @ӿ @ @ @$쩷2F Ip>rLV,F=k G3ܼo^7uKv[۪|K.m4|bK͙xn2y-w~b>f(҅zP&rySm~wG`-%3d!ڴOuu.jXIuN.:yI+YuFmD_2֞@Z%ecS#%oPӦְi7ٙC,vkg cv ᵊ&:w'MeݚqzRZ<7v=HI zǶ<{fv8שJɸYSM~3GڧTjHmE }hjc+$p1CRkֻ|F:`fqs x7+JJ6FpRNYbjI>*ʭC"bXnFj)A6;GXEi3pYǫkSM{I>gҌ =#R.Uxhx؍0M6о׷m[%<%ywtӕ*>`Tqc#_>z*ז(k\Էv0Є-x-6Ro;R2g՚>sHr6|w#Ky9@ +skϢPooucd5$X6YZ[NN`RȩzbNk\p81r7+T -{7Ea.a>o ͦ&Zw]KФ}{CXO i7xGNrN33l81*G4N4R\kN#x9"ռ}m ttxIp|);;~Qg7+ydva! (of@{H$]QvQ={C+N=p9H%,7o@G VjUXoBX7i-ϗ?oAbW Q5(\[Q|($+-Lcf{"TCT`lYsaˮkre:Jz5B|v*bV;extPVڕ;hk3xaYMNbS)y[ᣮ 4Z-a67֩MKWSZ Nv'6 cNq9Mj5$v+bpsv*|,yQB\>-"HZZs{~,{x4g=:͋//?dSvp谩 yG~H9͛â)+Zpϛ7v#VWr# q[nq+줧yCisA sYۗOڣRj4cwUފv%wba'mަ<vc#KksmK~ȩolb'_d}wwwN6 |}uHɕk{o]5>[)EREm@ѻPO|X25fv/+y96mx}L .k.m&O=\e~"#C R|8qo/33Wt-7o<[ 1YU,/knl:6GqrUu%ظr}/;0D $߸ۼj SFۻ'4}W;RLrw>VRZu8DG<aߑոŻ-9=xT ׹^K>38([ʽn!iEp1WӜmT[Tމ%wBgҩ;vT]vvڞkcswr&ևbv,%UefM=8_vݍ-kYÈsP.-o;+TnUl̝>컜Qj2վ6krbћ{h]W;P)i}kh/JMWnIEKl/.1*Gh&!qRs^6/捳)Vԥ 'Y;O&?<UtOGT#XfNS' 䁜VvQ~6lݝYRY5-8;]5t> @j @h~KuХ酻|a}㴵57:@տ @ @ @tZrm`+<.d$->p9PÚx$|5 R8 g#^ad*p@<d3]PBՋJB.Ƿwlm[*R…ޗZLJ)XAFyZNnI$;]t$zbV-w4IMr~#8b6fI H fJG1bE.ri8)\fFŹӓ7XoN>[%wOݔFmߟ'Tl~5hc{E;nm]&1GO]I6x;.i3{W13#iEۙ >)=YXwHց%k;3Ɵ1k2xwpwGgsq>A52IuMpqkb~C hOK u8Fj\Wן[7| [GKݕfq<6H蠀6|6 c uSx\c\Cexa;Tr~H.؍F'QַgOśs\ҶƪIlL,\n}MV6ʳ_s4};?cv~F7:WT1a1 u\tUX[{.v e ]ZJټ,_ crR]kc0s1kO3S}rsFYQ6޽3"m.*|7EneCn drɚ.cGmv ySv= ^^gk{lͪ|\%Lfvk]Jvjf1fĝ⬬2Gj'Rrrwm2C8aٍG^'6kdR7;Z/ 8ҋH;Fܚ[YUB`{dG퍢U.ı3>ި̗E4Eu ~FD~,wrF߶39偏aջy|zK/\Vm+t(4hڢ~k)t2Visz=e]uY{{b~Fmjw<8mO_VN .\WsGMG6T.|Qi}~Բ3:cqhp7yKPt@p!x" َ9E5~ákcPu@tC@uCPtC@ @uCP ~-m-,hqďJwnjY ѵ pyNz7t|j.^,DJ\.o;K%` jǽ͹0ՓExVO%Z ٘$:V7}lu{/iUPo-QN}5.*[y&캓1q yD*\P[S#m2P5m6mZ8wY[pZ5,ӁwqԶ'%X'\rgÑ=d,H)@ څGsqjQviGP9J3ffj~EA${GP(t'%EO%3 \l\^Njn(q#«ip|F8g7CmϿ e:(YMu/PC᭘ir#8>Hx긤ŒmeZ;Lg\ NEvB6&n<|ou 64sjskErB)ߖcoeNHM\Cz L+fvTc˦]czeÎ,_v_UTӹ h~1q=*Q#k%RM%g_DS}%S%Mm5$k}o▬橳kՒ}6٫wl٥+,9ݒtiTDrm&ߔWn+n- @_ɶdwHm=ipvjB-pmrܗt#Dzn=&9\$inTO[F`I4mDl<\nZB,67鼈ct<-ۂl^D*vܻ]чYU=n;ĭB.H-}|i8%|gy7TVٚ6%}s2k7GB);[6-]zt<;/7~imk/L -߿kU# thy^;,^-޽Z/+gEm+ZCEaW9!vD5"4ܶ67Gr4ٸ #RnzQ ˠʮoNin8  @@]:@ hVhAؕm*j),~' ]n5?п @ @sAMkmn๤:mCз RD#A-CPwᕳ0XnZpq ޶@r "@`4MH-7],hh-a Vh1; e5q;,xlZv+X7 js/3ݖ_ U/[#E +\rz6="ۑ =qnX-;qۮOGzSqZ= w ;+͵[3 (.H=]ih&Cv8]Le-~j>f9H/Y/:: mi Y]R;3~TdG+"a#iߍrcͺFli{u&pe4]0"m 5s@w&3@ǽeIK3J_"=b;sLf"DF_rSQXdmM٘۸깡IGqu/gVNkvBFXJ~ t(_y׫Q|Ш +u.uI#@xyfcy-M @;Hhht @N K Kt}x  AyVO0ptki[@@ѿ @ @6>G5ԣ`bWWNxC9\Z5TU妢\(x4/lJ= wƑC@tе@IЅHč FAK1cNiV47m.X+X8vqI8T|RO<޻mjs9+OG|Iq#dԃz̕&}| ^#54,pר:*6T5#^*h8pi} ڬ&.kKt-؎wVBK9єx+g>Y%`_]h9pb%'d&#-1M6J|9ujW;6IۆƣW~#+n6fgpA4yθcOQre:J|(þˆo k/m>lRCIONfd^;Iۜ8m,9mڮEhyn[ }EJn:6rwö٫@I!-Bjn=g7w\RgbܑԠ Z`4&D9NP T5?ˆ jdOEI+x xm˺V)f̏tiTW=Ŕ/kZ<e O۟+<fKmvagL\ +ͳaљu׈^mZyzl\8uЏ#|67Je%{Gce?Ujv-sA`|+,1SC,u9^IEIrxxcnT2w Gyi.,ԊӉ]mMN45\w^0̾˙  nM-0i6+lw"oW~f{V + 0tP1 \:M8jb'?=&[gGL:'M2r8.~BO9^XJS4.yM,}ȑ41jA9yZ'sXkyӿ @~%8c|Gm.sl+FWf\Ƕ~ dIQqgv3\E{sǶhf)͘8wݭQU1mgѵGlt[:c-7[pٱ~)%QMQWTZP8z9=Ň$KѝVœ:wDɉI6u"!l΄ =rj&]N"{mp1S6=5$4_LFν(7ck1h*i)1@_s|OoE9: 6MR9bP>pBׄpO WHg[}Wtgv}WM3е՘}+I1m\Q#,t{w)Uu J{죴8tVZK 8f~2?L=St7&louŝG$VH.30c8FS㤁HAh\Rv9oE&vxWͳ k 'cxGlr;=X^>yn3rX^;.^c;+J:lC6>9phBΧ}QZvdbpqmIYz4-jhm?$ۺPT׸j@Psvi5j?`t9t! jJw 4k~Ђ%: ܀s1 d@ٓ}2jHe㾡-.ipw"k7Mbx@&5GyHzѽk=Jgi^m6{66kqM°8 *j@Zt`8m&+Df{>5۠5KDdnRtQQҋ1ywX9%Կ @|cIQ?R䧦9 Dd={忤`h}^(789ow:> 3N:G(gdusHa܃͸={dMŰ@`ky\YsB\,בς64ivG mg{ n_Kq\lJ|i,[ .Η}fv*GK,5< .3bp{Wq׫t%k|[0)qqȩhb-lq*$ ُhxG2YYާn)2¤.lokY8kkq[yw Fu:V~RJ6nO,VK|%ښk{8gdlTG[AkjeM'^?PT;wdðuHx6ëA[ Q_țҌKKEU7Zm.b5ICQNû <kt-evWUZ2Mj#5/9(ɮ 2o4W{=UB =LYl!G[Iq֝ _FN֌U:sc,`:ܸ9MiÉS7 k[Zxi~LPxu3\9Ape[[TJuZ⊆*|h,7kеZr<\kmw:4*flmǫU-E.(VSe{6g;`o6Xp`񥭍s {LAZCר)asyO nST<0D(5Fw``mR͛r:7Xl s38E]#+\2;5W&Sz8kX'1%MIԸ9׍%(jmU]b 2hH @o #Spڴe9_R\緍֏yU,znm%? [Q^;%\8j ڠK@br@-Waȧ==&z{,!KEm HO. q%܋Z^ַmuag-.vcߔaT W. [&?sUCᤧ qY$;1qf*:~RVG![8>pl7s+9n3.uIAYjVNrV/nnϛ/b7hLkO9jyCluhdnMw]Ƌe\Ss~ ~&vrI'ϪGa<oQ3W̬udkk$trxmtq+Ds`~CZkSpIMf+VfymbSS3(q:˾,0InQS#x]v$t8G;' 15SBT~fK (Qr_k<\.z3{C)}uMa*Kc㥮\3VD3+Փf׼u h @n)PbϦeD2 <,nuA; ƻ SI[O>19O QԨz\8ĶsËݦ%k}#y B~vh|VVZ򳟧57K6ʜ^X뫜nqNkߛڰCx>jZuū3GIg8P c(ž\Sof$r<7.prӽ͍#n%!f;&ZɞS1ٳ"lu%u|H=1GjӼgf7F+Tj#Kz9P<5? endstream endobj 18 0 obj <>stream Adobed                       S9      m!1"AQq2Sa#$Bb 35Rru%&'()*46789:CDEFGHIJTUVWXYZcdefghijstvwxyz}!1AQaq"2BR#br $%&'()*3456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz?y !QlF*                    y(1T   sEO,ѰȷFd(ws{5řPN,8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹc|iŘ(Zck7ƜY2u^qf8ֹc|iŘ(Zck7ƜY2unqf8ֹc|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹc|iŘ(Zck7ƜY2u^qf8ֹc|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2unqf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹ{c|iŘ(Zck7ƜY2u^qf8ֹ{c|iŘ(Zck7ƜY2y(1T   <4LxӜrlEÆOnEچ-Vx$h@ұn4     |$ I@1l*G Z٣$?~[o->lO[}44S$=:{]:NKW3XdW_sS;mD,]_mkvƒVl@:'ԗL0q"-ʔ'8tjP~Z~`ZE]ÌP@@@@@@@@@@?y(1T   ryÜ:~(*i֩f9m+l:nW     {> m^vQ1k,c\cmg:.+.~C|)z+DTԦ.ݮWmͱPuZ=QqWyI&}驋KV6w\.,4UgU$#Mes}Eb12e%^Vvilw;J\ZJ|J哂{k9C~R\oDrAG«Ak$t-&o-nHDs)9@p6_Oj*}!'-_t%$R>6 Xtwm^^:5$W~ѓNiv\ݣZ/ɥ8r:[u"6omO-ꭼI!uPm[riYsFW9mRZ)a,ӞwoSUR`w3 %u+$b暕26lvBɥq؍UH?Z2Ԕ~GVIsdb8Z{F|OpKe]iSLYn~BȨUkŌ^}~C/ ֖jw!im]i@匝2Orzs%5eכsұl|i{}4r60XE32MvԷt?7lK +럴.rL:S!Nba]6.FpVJ<'=̰Rʣ +ZK>VgRKF'x%4He]3e !V,6.ټJTݤ|8?U]L\^v{c%,'˲q         y(1T <+-lEAI+ޅ%:@.C     agqRC~[qXHth&ˎUvj9yV i->}˕WmxcJ\[ETN&6F(ivSoi>zIhPbvʝ&Mկa"920-hltyJoٸ8RwKѾjI \-PCGXt%s簠i8 參Xx74x.:V5H,*ыNޕ,lm-Wqqkiesr1ƇS|tau)eL4EZ4VoQ^6k-܎q]%Jv2JLRa:=Xָ\'E#B^Ռ_-VjǘSC\#Aܖ&o\3VfŞm:iy+͙[:1%'pv!R̉kh\LTQվrVh*tʐ         y(1T JJI0w*͝jhXH6      >;qu>!n:w+yW͟_)d hkrG0kKnV7(e>/^zw{V;"";]gl Cu]Jf}F:YnWyzy`}K 0ELw{lIMEN'r1G}qө,T~ Y]{2hݫgՏKCr2Ű ӓUQjFw;Ҏڒ^W_<|zjG4] ֔⎔zV7^oMvڻq¢y L܎هwA3CTh^; ).]N)󙈙ѹn{\qf1gn%G[ MվWTx+%v،sHŶ 9 㿗z2i3[ά󴘋\4!X^AW7*YS FV½6,? \oq\dͮy.xYk.ntY=w$9a=̙'SkfNfܯu!X^lo!tCy݅TIƊַ\^\dp7b~k]wc2*EѩΓK߭ngu+ꏈl&I%#T@ H.MFjqڽ;qq~F|K*2J2Һϝy$ht!6Kjh1ô7trXg:W6"5*98j>  :Yj.?fBL3         y(1T ^Q|Buk܁]@@@@@@giٌ6 ٫09k!0wsr*wꚫdrN}t{n uU}kKeU,縇O#3hѿE|.Dnw}pХIB9B1Yіmm[Tn')'{η28Z9;^uږkwr&H}1Tk Yu#<󄘩/S]7|Hҽstk9on.٦eXhB:SZl]:g6Pw[MXNUլsC6Kh];7ҕ{n=#`&χ:ۻw+&ǐ.xu ,(MWm۹6^dSZFۃkC{-9jFxCeV ukJZۯ#]BS*j e(Ub,tYRWOz]f蝍ѱH1*fnC{2~5z*5kxߒڱ%4X8I &ja k35t䓩FqrZmO_fUvJWjmcqq*SO+z-Ʋ򾪾VyyҺ00Xx[ۗNRM3ĵ䵼u? odw5ʲ1UԌ:.[ c.X Z0i'G'6ՕwnW0Qk{Fa(u#]7+T˶'Ҷ^gӓYH*O'XrAp< M{]+icԥ4Odkk{]X>V@@@@@@@@y(1Tݢl.j4Z h7#      ZvܼcpJI(TLq=kktf྅zOOiI^mbbRk1:2G4/.]}ä#nrRwY%4M=B88$8ŸՇ"7˜J22w5Jc6~[l֓D-%W,i<,WH^bcmZ;܎ܖv[E)xO6OuֵQO(",y7uV;gߦn5f')lF-l2y5yt,3'}wv_r-emr3ԭ;D 氜9z)F}wIKFvnIJF[chӛ[#ٌXG%6]Mۗ>\%k,òsbEkKzyOsA+K6HХUj{/\-/ܙǢ;(-Fmcwdi'pjSkw2y%˙XtUl#߫)n|q>ҍ^ CheҶ;;_+^7@lPc`m sn>w *ӄ\צkfm[YZܭȑ&huY}MڀsҊd5|;=z<#[r3GhCe]5!?gY,'i;6hu<Ք.t ÏMp y3G%&`3vce'e[65Jvu\"6N΍ nv6pp۸t\|RR̲h־{_Yie7x$n]|Q2.8Z0dݞe[Vl\$FZ vfAii\.w4-a|1rz2i<_+a:x[z#H]hx;g޷ڏۀ /g4ƸGj66}?"Gyfg3{]x8Y})Ytձ,nGSa*UN j:y>J!xCYT+c+67E=EIf45:zg: _Z6xY{:-#O[b|߂*sl.Q.k ]Jx         y(1Twh#*N ˚o#H|      ;ű{;K!n|2ą_ꛗ"˧qB|+;3,]xP.כxv'W3:GKwnnJߗ]ȧt,pt)ᠭE]sveodeye8"@/B~};~3gkdw˔yIz[4lms-iRw_O˵fݧ'tY-Yn~Zf?H<9:,=k-˛ùvK=Hfn)_Q("C9rly^bonTSeKOc㇇}{%{lWJϑmnN8 0zx#i{n5;;'SjҴZQrVyok5]L d[gGxsݛ :3S5$~@)uOs*kO5Ŷ%. \5tL{F I6#UgKlc.wMIԏ-:jP;^[IGH}u\n66O+j-;v.ԬA =\it>u{~k}"Oޝkg44Eۖ?e5%t組l3-ṳgpw20wiFeJ^/*z(yM,ۈ#ʦyI5ќ"U$ʜc5h۟Z~^arO:=ϰAuK3mL#R~ [;ZN=jYl>;\ 8F+EotRD~pGhT yws|; |J4#PGqq'qT fj|;Vƙlplsr6Ry9b3}J (V߬N|~ifq^ Ź>?qlLI5#eNYo{GIRE'k6v#Yk$v咾He[[9JMW\GI Clލ1нk<r3nvia%©lNhc5<_0f9eשFN)n/kG;5X9,f!k4Oi{#2Ms濪ye&%JK;Pe.34O 0uU%mྭg00dGST-o^!Jt*`z4Ɵ|4'Q[ڊo;nqq:X%뻉gx +j2Vvvu 'tpVEԜSt^߬Ғ~b+Ix hx?BI8YSU ys=fכݞ_=4uۋXlֺ:NԑFH8~ջcw33ŷܺ28؟SOgmR2`Hn,A]ljnD=iu/f;u<xFAH p:>SJБf> f[cJaJ E'ixMEj2Z֏AJ\W|d|ѕeh>cMf';L2噹%]Mp~[#MSWwaOGI+d۳4]e!)@@@@@@@@?y(1T%{!)R#GU       '.IWJ:ѹ3r0[3y5EUe%n[}.Is}IܣG,&)Tx+9/!^ 5,1$rFt#yXBQ^ۄ[n+I$ydB*uK !@s o9:i%'|[V^Fɖ̻ٞt5#%eaG{J4\>zaϬ|`d9     Ccፌ,mEE!P$pün$.:{rЧ5VՍ5褗k3u"}  }mI\ WˬKHJo$X`Xѐ ]Hx ۪٧f1axo5{DݵCmsMMi>v~R5y ؍ѭ0z򦫷%.df#wI-#Z;kٽ})Fo\T\L71jge{'`qWvMӓv3kq        y(1T~aaS\\     X|v V:Q{-&و*jښ+%t==jEuS)IXO#dy{U0,5osbzϪݶۙqHk&Hp-7A]ȈIRȕYf`/6w|{4v!Q\Os=^y8Jpq吶ΰaw4\3Icg+JՋ޶6,:4 ./ѣA:&6;ZH8-y;j[Y^mw'xM&t77IǣEԫ+|4RIfJyp,_$"٬dxf6o=g0ր"ꤨ\+J^֑}E(ٝlvu`Nmc{ߗƷj >%L t =ސ0q7+Gf<f7:to]*S)x`Lg٣Z|65fw.zIsG>ɐhsc{wt]#4d}#l{euk31ӊjZV: 0lRsNË́5+rpf*5*y5%-%uoN%тVEhMmZ dy{քmSNp'Kx/ 9ZZ+IS嶶im6C+Kxpr{9\×o855֝wMFqnI{+7ug,vn<#=ǿc9 dy=DM$N-e?>Y-WwW4\ (q-lߞ7;wuj"V[O-'wne~d9 O̩ZJ>̙aKxF+_:5pEKյc'O%,@@@@@@@@?y(1T~a:8u      wdpL3>aGF`| i |COOZ",:9t/T>:5*~D^/\vwc !y;Ѯ߸nVJk6ު>>y\cnYK+ f22O1v@ͻr6RW't֐J/uy]إugi} (м+COol-umGfCy%\VoܚH@8J2zFѴsbS2{Ds ,#6ú.B$(|5ź')rڋGVxڴ;q]4M^+=GΏHBNy"gaekKm#Ic6 ي:N u93_^w ;+-Efs7j5?~Ow51 \m@F^\[w 5srEQT |o6{pHBw%0Uuerm]n|Vv5(F/][Z$rDM1 ! =Z3Z[c.mfʌ쑾j8|9[u!9)Fb#CIG'\ϥk'BpA%L\ske,΄A 9UìRͩEKRW׆c6WRx0        y(1T~a:8u      K7ꁴq| G>[BO֓oCR迪}EK/NݮIpp%'n];.cfGU7Rw}J4fYUnDIdj\3;踷@+|yNi=&i֨[[oP#-E)m^9;uW*9UTxB~r$By^(;<loI˕wRq:oV>W~F27 ̠d c{ n[&W1;R1Oj_]~{3Ya&ƺ<6=Q}^Sl*8h;g~_yH pUŬFY\ܹ\25V]'a4ߊQ|vZ7ۊc2w9:TRZkV;+q@@@@@@@y(1T~a:8u      {jx-1)%lN˻cjAt#wcu89;!,uId1y8Wdy6ĞWe¥MJ}G]t$1 Jy$RJȭϚ<(4me4_K9:s18n$s՞Wbiz\v'KVB1.-H? }Z}Ykm^ n8je2Z߸~ĵ9c-XJnw5Ka,L&@:כs=+ LxҌw3Yv]K}5JqPs]ɰo:#a>17 &rV*#mςlyHn V:Ҫq:58}0 V|[0/ EVg#E       y(1T~a:8u      u}řA| H&AxAuuac2KDRu+$^:s"vbU㲭բY+R}ZqhlD|Y3W)e@WZ2X㨮Q}Xu*<~Uϱ^9 &&hȀ28kp7۟eo)iF6!%gjyt_[f9tmAfD3径yh$ք\^*pW흭*93FsqYݖ>r?ܪIG% m/2e0xkOw#:3&3Ur=: fw,Gqsuˉ#t}ߪq;9ԩIAQ8S pğ[mu6K7;is&`\m抋$k4v;=U͗yOgݱ,B'9#MHߥsҞRQt7M G<2{9wm-Ѫv6;hԍ X`\Y\vhh:qolSqtt4GM^ܥνEVQ̃ce&zx-ļm%ҏf֖Ľe1^ɓ/_ǰIN鱊.C\OWvSFχ4N:qKJc9['!1BnMps͕npxqIJ4=nf[6ݖوs\2kpZ08u,w˷,_:!rRӴ K_8+H:]~9m%OcTFS>[ Kqþ<+AYty50ukJSMvGj9'zHy%]2:HN:r~଺<̍њ]`ד\,O?dңycN`\$h^'Вh,c@#:dd:M(/c'tk^F-Ϻ~ c#;x|-]f!7@@@@@@@y(1T~aaS\\     R5.ӱǀώ& nW9췱φyjt޿!wFկooe׉TH*vN5cb܃>UKe\϶7pUJ)g|,QzOU"te*nK 9E7wy^uGgzKq=cl%UHy8-eF/y:[_{w{pըKZ˥Y.s-h4BI8\<. 4ݸe V3~եk%ܖ]nt/tTp5OZZUےNjWJ7lQKKOEq:W lF XHa|`:UT: #Y+]Պ's,H NN$k’Y_V,m_\LiKeqMcӽuZփ>izfj]+zW]D21c4o"R+V=ٚƮhsX.ƱV9of/3dYUԕKvh;E[x -]kRg#t| r7v[Vjo߸wwԔ"ݢVTժwڬ2 ꑳ81p3N$`qЯkw)8[R6b$Y[ͩΪB `Fۻδ9x˹+)Fi_H$!7/S"Q$9N(SmNW~R5 z8Hh jg_пg9X]9Gmycc<#|-Ӡ۾΍|e,ZQ'd~cPG@A<\"Tw8Oc'थR)^u&3Y@ZF.o.^NH'R{5dYv'e *5`|5 -e [|*_/9pr#>b2xتENϒn=*Dc#8U.p-@@@@@@@@y(1T~a:8u     4B=kERTX=8a;f|Dl 3h9Ŵ^yVGSզ{prj9ZKTNQ_X%KF7{d4؂{+I^sN a4Y]E kWWEKW#>7ГzNKqdׇ/vjwyZ}؎ QM;ՋnmQ7[08wNU 'wHKGQIWfƷv5{aMdAܺ/v|gqifz}.K/ H^\F]]I^yc 'b9/Q+a,xn{|ۄΔ桻?9|Դ7t߂F]Bq|YC]cfI ʻ8*{*ۊe])Ν(5S]ZVpjVwI4Tgj,'-k5ŶM2QUg;]pi*T9H-tJ:rQAƔFGk'ҾGc.c5İ\H湒4!ͻ igp4!AjɶsLJ꫔i<ė`b'H_u̞~hJmw\q5sD,sx]hȺI荒FOqv^í ۟eou&v<dson Y'<;Śʨ&nK\ [v6] qҊu1{< xIkەr^-^]K6i͒+vO!4⡗B 9Sp'flˠE*SV|^C۴6 FPi5,T`:ZqjUVnUl3j#haڃQRHe[\dX`qN%ZU'ӱP*yټ'O 0 pw4եK]eZ.X74ԋuf{VgYʥ ^.wy֢abyAwfmdu m/^4n*2~ɿpHwwѬ,e޷ns(yq7|sVza*-\ϛ4dEGoz6;'JGZZ=.6g\^D4.s[ʺ3[zST♤p֩Ez5-^K^sѺc6cβ:,k}WZoUr38J)}+hjmW}nFUAS:^-;96*SVgÒNq]i        y(1T~a:8u     Anb$c`i 6&ǓzMyXQQqM!ќK\ENVHsfS`Z۽KO)cHmCJkH a`l@e 6 l:};=dbe3g=΀wR[ڑr*u^.t8\ 7ujVg4)\ݭ6|]sflT6(-e. n3WN{EDZqwcIYt&:w83~c-c$:5!i=UOk#4f^+3&];B2_V^ )l-EGb6 ڧ7Uԋ$:WFu)5vO[t 괓V^m[~xZ M.UbO RijN5}.%̭$*i.2Ի-t\ ѩ+1XJ{'!vGT3W8,ӹ1m7ާ4MfݗQ i(Myh)Y,:#        y(1T~aaS\\     5ն(6j)ekk L$顕 {j5~vpY{/Zv[^K{nl}҆ⱥ*n]6Qr]:q1rO<%5Wەī0,*A<5U-O2WURSmG<窜,YCꪞ֛4ߓPt.RѸw䇳3Vlj56cεn:[*B;ʝTǴIV,x瞲N%,Y~AS&؍ַuK[ilPW\ީ^J/GEiF+,#W"V7QGʘv{3#"SaȤ`Ξ!܆8 -W2晡ӓxr.}fFSn/:ލN4g&ka6n޺Nh#[x qp#%pOp9iӺun"6R4<s[1o9;E#Ga&1w[uzWNI]CovUݦ5 EGo8ѢgU?2×qwns]AQÒ KA67ZʚH3f&yPBz4uЩS|=FMΘ'C)rܸlM1K¿2>+z-8;F@s2r۸ZW,gJ~ .ݾI";4 [pѐ~Ps:V2:tTn&kWA&'׷.{|KlGB=s ^ooF~sB^ɤ-h#ȺG{;Kiht{O;25tfxn2T/TNJ{u;l]̻g,sAi2 gǫŅ򓥅 VTuoiW^ J^2ՎOſ[s4ͨ)Zno s4@4xι       y(1T~aaS\\     sTQHNIiX׺ 6ޞ^ѰνR{APםݭD,-XL7 8,r~̏a:Mnrmjv!=Ε:1"sCtxԥ']ټMeɹgfGdhsqλIX\IA=C$Y@FɯyoG#5~CWRkn\o/>ںLMCT3C -=+-'9%JYϣq?[hZԝSIjIYM[cmo;yc#.F[ 5 k2g`V0Ao?w)JOFr| p͸>ഔR?HSXsͩ.634;ײ䩳I¶ksn>7vL}ױߜeÖ:8}R&Qkc`w>Bˑv4pWmmչh&1ǖc\tzW;tiv8*Afڌ>2%<ɘ+}t?[3'u+V֌mML[jOTat<4qC7$ou9pw6;Gb3:5%*ҍn2iݫ4z~M 0h0i4B\hQq/uWkIݫw拯en!Q|yUvl.\OmSgP       y(1T~a:8u     C|XnOHf e$Ͻp5ߪi׫eȋu`OmLkk_5rcxt8IikQޅk>Djj۵e-il_]$LDk ~Ȃ6}?jTעJsH܌6i&[n}M -EvV?25"vV9iMR4dJ:L)`mD&#'up`ey:=)6;Uosrض٘kf$cW[̹k܊%Ӊ#АHo]35fm:U$na4[ыa#j% dy;۸jcvTq1:Kw]NuŬjt {u+e7p(  ,Z/RD.*WyFTbyy>Etq̒?\0)Tkļgѵ>lv,MK7#¹aãV=DznV$cfkGgFY:Ҟ?LO/5շۜ͋v $為:*ΙZ1^ XZ-]j8D1`+\)d,&TDf^u.,["$>#ךΪX׼uQbFYe^[zJNYGUXkTҶF +Z޹ԑk3zӾ:cio6-UGf3y*2r/h7$oq6r[Er6bA"νvo&>x4uLs y"NNccUms$\w\.i\|,"GbưW8TІ> Txy:bb,e' fR3Vݜ o!$!r^K3aA4v,994o9ȓNjxOsuRU.Mw8 ruHIة8*kv`FXCNYJցӔRː@h5RR| E'U+KI潶ϫ) ;Phԥ _Hpo,W^( "JPÚ M)7snjb;=PtpIڎg16iEǍqfG:эy:(l|fˬHyߚv ;`C[*S#*R[[{bbHI[䇁0 s\pb֐r-SpVm;Sm;u|íMՔu$w؜$KoYG.S#Q Kj"3$-utRz7ij/CW3}7M'8}*tH`@@@@@@@y(1T~a:8u      MJѻQPf#2Qg\*)(Q^fa[W問7]Yl[֊h? ,WFYϑZ+ֿ+GN4 @v%8/ X$Vtl#xB*"hdX(܇0{q}'SN-mqw޹lܡ}C-楛̍lMmY))E%d3x_vWQ-,mrX2f q-|;pqhm3či>XIAD,3ճq)y0XTή1љ{oۭJѹءIۑ;({xjիI"[ p4r1#Ŧq s&N*4uc3Mm{rܪRs[iܧǪ!c'/At,Fy^=T.X[[pԟ!NGbzN5yl4 ]BCKQ-񑣙ӛ,X75tAt4 RJR\-m@@wh-Mu'dpwG.=XE֕KLaنbb{󌄟\wq ?N^)t2>/%;-it9|Io[YK]t`esٯ!ıKZ[%fFҺٲ;Xoq5fr'S'%f ,9IӣKŴY5ܖ}9ܛaS՛fl1[b7  |fqs4\W{FimM Oi#ijYWUbqeN̮ɴ   |K}@Z\V  y(1T~a:8u     ISn#ټ=e$ 5% 3[طpDi<^;Xj:b˙y^E-on,NJM/ϖ6gU'I,}{TJBmЈ6 pS8IfI?mIJ楈OpjY%k.ͷsQus ā -ܩ"K%CNYrfd$>Bfp<n.`Xm3xyΜT֮i-K]jLѽE_ BIG\|=й-^gIӍz75iҚhöU6gmH?{%\ hԚouƽ柣lʉ]Lp8َx RgRx_;8)P-XںROzG]MHp,U7Q#c5 D3pYuMWKaMS-I>gҋ@{CF\.,;Vb4vS73NN ,9/C˳֜/G95xgmykw6OsUKngc Oq\qURR2ճjYshr7XEKID.5&ʤ5-kE:  p9n^;6|g_:mMb8%|y u. .N J:[T8s<$AB|W9F;QB5}jq[M 'ء);#ζQON&.ջp ^.@irOQmyWs{=%HUӚ'n5}rgJx 'ෳsWٷilv{ eJn^iOM|N)CÃdq9-?\huꔒk٫%]7[\C p 90yLqk⑺=i ;FHUӸm3Kᥭ2M4Ԣ׃$iqlRZsN:FG m }87{魫5.B\b ҺI cf⵬hxwM_OUf:^=gŝ8-׃+۷iqZ xj    ,h˹a+[  y(1T~aaS\\    ~$qcsEN ]J6oDŽؽ><|/|Qx61 sz:Usv_Qێ)BګgpgNјxܵ5<%.Uoe #/wC\91E,J՟ {&Q[MKvJ417xĠEs]kěkģDV7-%%mzSjnKZ֎m5mF :P5Zpu u^&㈍Ho7(i8JT&wM]j_-CF;_ΌQp*N;#SDF%kCNJq{ԕ|w\Χym%H[\f[ }I;Yz'0uDc˺s<_xxݺs:wv};>Uf);;~Qg7+Dc!$u#đv7UKŲU K]#.pspoͥ^Z\Z Y.b?TSvp谩 xG~H9͛usx-8kkzb5iofB>qx.1m/x❔O0s=.h$Nk4[zQGtAnvTwٞI]loS;1?\YֿBTܶ6R1Z[y2>w.ZYHɪ,t-)"6 h˔%Gq OV; 5-wWVmd0S 3snW'vo0y,LnvG_n!]AlX{~RWy*g56w#8b*[pk} /;AV'Hoq Th7Њ:Qji,)'|El͵%YڣJq^dDtn>[%8n.B^?255,>38([½n!iEn#T99TI%w/BgRu";'ຜ![jxns.n.CD_t  q.)yn:u7G#g!u@Ywpʔ ʭ'O\n=F)ʢ6ٯS.+9 w&Z ;P9hJ1*-є_Zқ$}M6ԔTp*b{(۩i--nfok ҕ>Ú)x.2jJP޴9ѬWM궖ֶM&WM]R:cVnh뎥@@>!qK wya}㸵5pP@y(1T~aaS\\    }Zcm`W2x\HZ3@x>nCjjn& x.Jw7ӨHh#<4'd2I،B;AA.'ꩆI ?ۍs.XDHRyE6z6U)KlgB+soXAFxZNnI$;]t$yBV-w4ܒI-r dF%,plʹ NEp,1sI1NRݷ%,nl[91~RTi؏V\'ᔫFmߟNk 84w^zl nS*L=zY$ظz٪y|\#O+$iA˭30=,*tF潼'؆by#$ˏ w>O E}8^Z3֧Rה%o,^.g6jꦫZgi[.`0,&m$B(!h'tqx+#ZIԨܜn䫄e1RZ<hfڒWI҃N}(9e4 "N\J.ogasG+/U> >fxpڟ>6]Հ=WsGMGX )0\Qi}~Բ3:cr8yT7;KP>Xs 8p᎒9E9kI -,,{eA@  @ 4 ݢƀ.18؝hj F y(1T~a:8u     ipnhV#KݧGƭ.nMIO+%cd޴@[`WaDů{+vc,^㓛y\2B ׽K 򛂸=ic$,tv(ӓݸFF~k >zN=#*Pme5u\#܎F.#dud/ۙgVvf 8Ψf4w^ȗPo-࢝jVk\U8Msu'TL:1|bR 5>Z*[$p҈6(QgқhmZ8w[rfotx-vgiwiNK*OR\_3˃=d,H)@ څGsqjQviDΊW@u14B$CT\ZtaA=WrwFp&bpTTS8.2Bbgzu#V7wvfF Hg6.ps]XCrR=fT8.ٌ,8Z~Axy]%~dkXUm%u#df GE8< {oxmGp1{7@jGJRb#$=Q7P!-X{÷FL:V4Eg9:mvGNWymgbpi"㆛WrRY.IdT]g8祦7|߄u]tuH_Ӈ+~#=ͻGjck%rJNs~-wVjDLDo8joJ9X$Ҿ]$Ί;t8@K䷅lo2F-YopK]ߐʚw:XacrIBU$VqK%\g6p5·qK6sTѵjky+3ES 9JYdgnC0-vI,i$X5o%i[ދ5ZvY=?Ӻm-3V1N9'K'nV9msݱ$/5u~@TErm&ߜWn+l~rLg  uQaGs٣ٝ` G\[cO=:,ZĜy"5ʷ,lGp֝RowSJ6g/)TOM[,-[ΪF2wxzjOӔ662ͥkAha89,Cf<ӛrQK/}`:;seVl]Uw|tf@@>!!.P  h+PfmPTz~-Ȁ4]m;- sZRD#A-Ǒ9ᕳ0XnYa1Lmf6Ώ}< 4#Kn2c@tpM@mfzGa]L'e\ C%u2Ճ|TKw=kyfZkY{(i\"䛓ҩ蔩W&(jȞPRVEѣXτuOJcsn5+GӃ5eyrkEr0 rOhdz.mEIW!HkNst&mL=uH/9/~te2Qg ȻqΥJvgxɦSf~[.)icFm4 eKۥw3TK%G [7(Q$mN[r `Big&V5p;QRz4ݑNv r ı&]-e{Ft\ ZR{z{4v D+~(^[jѾ>V *6\@sI-y1': sm{;OW-wFfx]qglQ +CMD-xqYi)xRFȸcwb:s,f"DF_rSQ7g 1qqsB|_62Wy;7d*klb:…zz41vΩ$G9=w;6 E#JOk1Z[FZ%~m.5gpZ4 xvm4;Sh@@4d4tn >t4R./"~Pm` WR~W|*)[@ y(1T~a:8u   ll|6kq=F#Xf-MUut짌;3l΁uUE^Yf)f Rᆞ{.Oh)Akl=ŮΩ^#54,pנWf[*aϑ*h8ni{XMkZ]T֖[)rRb6 /xAΌ][=ψ+UDys);$EoT g0jfg;+E4Gm͸Ҽ5]Z0j9ͥviQߐWm~7UဂiYmpƞՔ%-cS )7x\wn`r^ °JHi)̋'y '*$uLKtldJؖĉ& h h7ʹNZUF0 {+npngi`̶nr(uUCcauٴ9w4sζrwW5h$% s&f3~]W؂7$ZP-0BE9Nu>!>>!@*@ n A@Bq-M]̖5ˡ>]?jo~K\0F. [@#u-VN|ny(1T~a:8u Z }B\#^ID*-eU4DOZhjsHim \_4 Uq8^U:tnt& ;g1ڷ5EǾ0xA{oH*+d78s:ģQLa(wsrֳ!tޏuW.|Jpq88lZomϽZ}i2]vւέ pFa{g`lVFF2;[Ѫ?'@c3 {Io$m{NI[]AOBKG 9K\O*yxIs S}iW OEIVۗsY$xKI5rbxm>UKyŬ=;[#a[4tTҚFija}lDz8Za/lW< ߧT6fJ])]Mq<5s W7Oᩈi7'8Сk F̢t\N ГtW==εT5hnbu6e6kE-~_ Y%0vk[q|jlr9ћFT`N,rB Jw<_MˍQ7W͵ѱnR3X{^d42I7\_]W<ȶf!Gi`- b7!$P|C@>d y} CP}@ Vu >] d?%$P2_K}:G*y%E lm`UcN^Sjٮ;;>1jA9yZ'sXxy(1T~aaS\\e,KJѴ٪WzqFL? {مݲLXcr^^=|fv/)9j-i{6:4&f=C4Hl;E^fzre r3ı )**[G'[SXxBI$ 8gNx1)&ζ^-SЃ|rj&]N"{mpXqN78ؕVf}w 8ys)J*Mm#xbTSc+'x8sw;t4tmtf)C+ےڅ3 j'۸+6ζ]u-WtNg%%wc/BVa8$ŵqF܎hӐR3kZ̜lwUå:bXh36f)eZY) аjvf%t%=u$Zj,op*^-5tTgg)-lhy 9j C]M/ѥ-h2:G.cnhM]-8Jぜp29$o[3mF6$fNH-[ulWGj GdiEc\! Cq[Lۥ1i!siB+q,y-BכO/0Ew;IuuadP淂pkX+K1Z'&=98匲&I;CngQC*ѽlt_i4t .F o= | 6ܐAPo8{buZyys*Rv]f909.ߗ#66Ѫb%v{MEp#%)ory%c4! C[$sEIXOtqfrR de(Z4]QP8/s5G4exD੊43mሒִ j~?b4sߐMkE$f`꺢1k t'k|˴Ͱ7"5ո:q<lFX5A̙?;p5ʶGj1I|0xW6N~dshtq5c{,9%Llm I3ܶ8Akj^:H$u'c*t\ vᕍ`;o)o(v{7D:|e*Ur/u})GMaQVF`#. S4T%X[RVk&M346nm(KkZrj@(9;Zn4巅3qb@@/-@>ahAmPҝ=԰4Ú)"Gs >Fx@@w f<?D2o48hipuP49"k7Ml3M_0k\MI!kFWH_#] =vvSi#EFʚ,@A+@n#8m&+Df{>5ۘ5K$X+袣dc=ܮ=+z9dy(1T~a:8uPJE.Jzc܏j#'rzv-$'뛢(c]yGGdӎg,3OBfp zAl:s8:țaTLKq-#%YsB-ka߂64ivG mgyŹ{E$ms$9bph% vuZ6Aٯ\3@㍖z\tԞ@7(7Ni,DbUbrWl؃ sZl9k8m/BHi UVOaq8JtZ2N).Nr^6CZ>NXJ^/zoXЗsHUWHfnJZ r:S]"ҾC/U)hsX c$k\L,,}>$wr&0#T W./̑ 1W %8cD'-ci=??BӟqjTa~HcvG\ fs٥t3FcζR4(+"yU7R|sn%:z|H ߙhh֦vu k]>$ h.RY&|o ]}mNSV6`~X 5o5D-,>cA`~83=sm p9DZh 9oÂ\xԸloAZ\X7, sn#rgp6`sv [;{Rh-n mA䖎Wx[ 5 ǠA[M$E}))7۽6ԭ dvc%kI&XRI>|ԗ^C)]1cAQ2j2Vb2b/,r 6Ѵ*5&Xf *(v.XN荭N}[l^|+IH48Ibm^; w=u7HS_X婻H}ɝ$qk1=cqucs]Y^̓RgoK|VOD\FӲ`[`FUO#431Oh{gI3[H(S447Õ1`E.dR1֫'͌.Sh|C@   O K_Lʈ!3qwA;-$}^Q.;``9mEۨiZYv:vsG*zd}pt~$QZS8ـ V1g4iimt> RU3#1džG6*Ӽ53byO;i)WE3cƆwۆm]`H)w8>'yGƣKǐŁj"ܮ-9Oi޹xI0Řrq-{8v53fr72*hfGyv9`9ENl\3 /`yZwlluF Y;mq'ltjܩqXkqw&\׊(;[(V+2`QE$d{u8VOk& 09Ɇ3ȀޤXS Xe`hѵ qݯ?p~F?PӬ,=$q;8Tk- iön~1.5䍍=린S\3Co\Hz}y Jby{6F%HL:F []C^ѻW {+ Fx9;(jӪY,LnR([dh#s`HZ&m;5˔s^p}RPl j7k&64NlJ6ιCK++NJ,2fwlT8n ٭zKˢe6%cX>|''U7"1[X^K)!`7xNf-:NNH4As^RQ8ڞoa%Ӣ7wVηRlɫ*)Kfԗw+[Ք]䬹#s"ge; SC5r=sʷ#r8@mrvy(1T~a:8u `ƾK*.ŏy]Tjϵܩ'P)~ư~|ELW÷FmF짾Wᡵ>YSbY>vft#Eudjf=@ʏzеa;[$ ]:oG ;Cp[Aȴr-$l0gH[FmZ@bZP9#H8+=Z3Ws/\)qo5fDk~b(>6h=| gMg?3 /ځ+lė|I8ٞ.cg@[U'p!r9 endstream endobj 19 0 obj <>stream Adobed                    !1"AQqaB 2Rc#$%&'()*3456789:CDEFGHIJSTUVWXYZbdefghijrstuvwxyz!1AQqa"2 #$BRr %&'()*3456789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz? U U U{P괤<5ohSR]z;iUX44:»xRSu⥭XoŃ֜$!Ĭv)3ŭ{# Ui/ `ƕ؄FdyBTM=LcT-gaU86)&z%f8천% 8kT\\\rOy1d2[Fm54 }TN$*vPRV$#`To|C [œ/áEJqyq6vms3KLKNص(E|>T(3 zZRϷfg |V \ eܛ 5'"u›ϝ6ӕ."|HE5iC \\;:%2Uvs !Jy&^EaG1.BgY*u#888#$$$$$$$$$$$? U BR9#i `zEtSpFe !٫aDo~XbY“虼3U@:/om<+iM~JZ)ww] h$rG(ƛɘk*Mf<~X5dy/@iE&'%?0葝!+4-<'i qF{c }fC֔͡ۉ J`.dDeLq  UIؼ`)7SBuV9Pv] :Ǩ㘏rv\/b*˹ (d;0^ߑ{gd֎Yd#Yaa+un*#jeLuTc9i/#^.On H9l,%Urz#]AwPE I>.8sэ]U;6@^OG3W]B"&M¸RshhR4djBspMFSY'k>ehtk9ؑNJ}jyў*N\y?~GNY37n]n_e+j%Q-Qƚyo=ѥm{\}ِaRAHHƔR1$͐ԜqJ94K-Mi6թ\G9䏋BM%'U/Ġ5ˋ0H6OC&4Ċ4- -tt[Nɼ1ZXE*]˚y3S&vіL,,sx+-U=68m]H *Ŝc,tdtI^/)@˪Q8!]ks;:˳![IƬeǙ-\o{"bG          UOvT0#C&yY&#ZgO=IU'pyA %MJ*jִaZ)ՓG;:ĩJq}LcSsYjBiP9G-etm@˸#Q=td>|IU3MƧP+Wz GMiI6x\uҖ;xk8 Y pI-4b#Δpy-Z}̯,F*3Zyd{N0-kx,/Տy7F,e(a'WW\Z1ԩ(h|EMUŽQMŠP9[n[FO(o"B%V z݌!On3[IU&8ӲxA%IuH%W3(,3٘8EBJS* (3*hB;gWR}(ZA73IF./[<3 Ѭ4yH%ʄDE y)*N@dG%b|a|)w^AAҩ7Vb*f_ U>KLj fv`]V%7+ƭ7]O4N:I$[YW!JŻ-N"ħ$&40s.;Mz{oh12ѕIQ0̻HHZHY6RAcgVFm{.%^\<&SGʭMI5ؚkI}4uAJb洴9lZ&Jʬg,n+nUܸ5Am6 5(zk$u8_G{3Lq {Y.W)HHHHHHHHH UwKtܐ!P2A֌V9E8dH> ˧nAcI@:`_(BYz m*Aj6$&3'F5@ĵи5l:h9ҎlᘢFVFS$]3(.-J -4 &#Qhҧ-r:8ӦWIjsde[no,֯fKA*{hD2ܽ]Cv޻2XJȩ("ь2v8|iumYiV) FU I.D15kͳ.T  U/肓=Ny+\JJP.ŬcqGsq)]Oˎ@ިrkYx& ,'XqfO[v/=-710JҡeoJ$f6^ZT4B: :"XxmE&M׼38(zPĪBMM۫uaoo.oMmg)Tmm4!&#ث)-Eyq@焉'蹬3P0[ۢթD8#[3{ȰZ'葐7-MSif*c^ (y#IIRy{.tcW-f^' /[[Sw~hXqp2YItLcM= U*RP-j B*$6YRm䁅1^<}][F"_VBSmCx`9NjG$I1S%v1Kb>[tUd9ՎK#-U36,Bs$[d|{j Թ,M^IT.A I[:VCgxmVQ,<YJie9$oczg$'@;Rf㺵+4>Z1Ԟ+ptvzHsZѭR)>{v ai;3kOθB,=ba.&4ՎH$i qg*h6ܑW$u\jKW3L@Q@TfS,b|pc Q}YvTwidh\N6՟|򾑇xJ|=X[Iz+Q[Qap y4zk9'6KRr"$T,w UHΐ5LeVܪi;z\jAp֌a}G Q"1Mi,@BFl#PM˨TP<<5馎U+RT❕Q#1[F:⴩uFU\o(5ZieHi$[TBymegAB(uF=Hӭ]`f$JCS_:\A=5C&|IF8ZA;{X]bJ MhufvS)bȡ}(4JJzQZQtY.o}Vδ}07Py\[/u U7)mlQEVʒI(o%^qL&Vm7)g!"<*HI6I,0+kKRFIEMPc+ܻ$΃aLmQ5I8ۀ:Q [dI6<"8Re$b16Z f"ʌ^#Tp;)Pa pą|[JjAIo2R'gHHHHHH UO*lS%8.Ub5;a8ыUJ/Yqń q 6L-,$f=1m |X Su<{Ҫ3IF6ĂF^Ci[]d꽬TjsmlQ㪞GAɟmV[`޺m6>Sj9S.CuuKK˝ۨޭ*a;#UR|;W,ϲL)i;B}GzF9ngÇU):xcܸQEH JCGf3a<.Mxܚ;)J\ǝKxrXųL4n0c!iS"Z;x,#q:g%62Bv^vur6RGfܨ!yqr&BVi#<9¢sGʑkg1N1QPFW;:!9SEM%eLUB&G#١ 777:yfK (ҩFP@PT9xW5}“rVM* 6$`dTTVGe8{%:(6H /v8zpuAY)Rތ>Lˢ#;#7QO qH0׮}TzhSof@h&r^_s|RaM4B,x<}:7S b=8iE;+E(uҢ4G[ǎ9$:3^ y<ʞz&8RYR H;n}qy^MzW#Za#l}XEO9       U'HueC%w_lIo. S*I^jBrˆ1,$ @m޷m.|y%iXxcF}8,6&\n㲅xc:M :Xˉ*~2OyDX'Iyje)Y%;2w͍Z72g#ڏN?aܖ!RyF4ew&U>H3(1^굀E=if1&<ўs>R:؀,8K30Zڮm{/IS%A-VaCHXӨ'Q.k n7ඊhyl:K^̫yw”&]N1 U se6Ot>+8k8ZymI#}£Z=F:[71l|Uh\Sg :שPKMI9Wǻ5ʎhDbZCN@@@@@@ U;H ]MKzҤ{DǛ~UB|yuR NI;9c IYJq*U ء`#ўQ;e1XzmԑJHqog*ba,qd/!L1(4Tɞ;J>+!Z$$Ifnv%kᤶ\\q`%\Ӱ[UeKz/gNv5HSkd*E#;WT|qJ&蔴.( K.Ww#PE1:H[HnR {"bIϤmxIWP:ϔ=Y]RZːL2ABTZ.Pːګ쩚|1KIgd]}R;.)Lo[z]2Eh- Rj4k7Ǭq,ZG,'-05 R*u'QFV0=w}r'm˄,\a֥Oy'= FudEEIJ+ceiL4 D"e }E!E*Jzݰt8"m xt֩-o1m3OlDL;Q#|ِ;us飺z<ʉ:I  U9JdӳϦ^Y-j;­XӋò `N(ݥRnOjzt[U=&8.dm|[A\CUˮ̑:,YqZwVIEK ZZaŤd9Eۨ Sez8Yԩ  GK1*<8*JѭjC4z(WifkTB ehS+"j،mFңeٲRlb?wOaە,I.nxvr;Ni&tLFcz[J;sٌt.ۍ}#VQ%$G ZyTLwRnQGԻRIu4$Jks"܆;F; Yie]K% c;[;IՖL/>;r<ïWffʜIVX\nBqVE25n-vi,S(t*Ju#BoV{䷛a8є]M-8]4ua]iWQQ $!]Rϯ##K32 IZ̛XCY->U|8^%-{XM }͜ i bsMj6 JҭZ08{I÷x^;)T|Fn:7u^j=x~dT̪`T'MJDUrUVO|KB+ZԞk*VEbvML 8Ө7JҡpA'4$%GAGHHHH UcL~^KQoĻ-jm`1$V"s<ϖ#KwE-|A"􁈱#zZvqKJo`"7uԯrϢOhݥrO.D}*+%m͸MM1Vyw39qF31NRg$fVNBRxrGEI4LѠ,8rՒg=2V 5T`Lb2:ћx֎O}o<_ 8*Yں|evTxQ<L8 H;I1ݚgW|vA_z^1{G\J8 (VGw s[hImv)uc^oU-q(8jj'pUƫՐlQ鍼k,y;XemĔ]B~;%Z'T(9Ɛ6nq!HROMJ)U3&ڌ M3qO U+$!E"ۖ -Gjs>>)*7QZJSe*Ͳ.N1ĒC3=LeɥE/[k=Q>X!Ie{`dFc:ՌOU y|JSgry tjmGRtoR5(SUi3 VV• cwoR鼚=Q*q2e/cO}2hLBR3vUa6vY^vv͆{QH!V:%E\[cS<9nk}fiv\|@m*Z։+$b%Cn,}'`) <DιRQYm7,}GJVdSePk}yykmysI\IU ' ry#'k]E-њ1tlY$k5<XIg-uc!kRtʦNjeǗԛkykQ/Iԫ%IfnT&[[m%ؓO58Eu>AҾ7z( PT[!J}GFo [_~Mb1.h6Vח94"YuͷiA863jKF%JR;T *tޢ98NrSt╮99>FuLe؍xmH=Ehc F}աK*)@q*$yK`16$m'JXBqDj(a1:1mwRJ }ƥ(ui5Ke97SM&Aݧ&Y9ʏ}QuvūN]3( Jc2F`@@@ Unl*KTHʽ0{1m PMˉ6v[*O'36qy5FP{N}+P @:Y4|/l{ݪKL뮸ۃ9Tg.MÒЫ),%ϔ9A&nUk{mN'!Sm$Z;c`㮲wm8UJ50ԩʿ*R>uл;ڪeRMpu|gJ4\[Om:s[pfsybzd+Zn IB6&/X՞qMGB)<.4pףJV6:BZn$74odъE)Ů!oRIN^YeYG% N[ EY/#5& ^[YiZxr+Uu I -­Ȑi ˅ s u;o]%G{IͮK:WȲ0vPJ.E٥ gM{'DW^Q 6P2H8y{ ^ujdͺ g52r6?G6x1 ΖlvY$6=,M:;ɹ~!ӻjln) vJdzEIm,.g:V[ k 7ѦjfVM}@R'%RriMpiUvXJO,mGhm$w(wĞr<0M6 2(yIKpzi1WXeqOtaͤ6]vYGyaz Qf< g%^UH:Jmne움Fwd{i\[Ц'mF7HhM)-lF0lRqimds)L_asus#rbyZK_"i!E2]{(WbWl^!۸P[˶mܽ-t<˴uhʭm>./o&GۣܳMXE3em%R;'QȀU$qA &uzHSal .21gHيBIN`8&j.ͩdSV t_1q|꺜U?<[qW9pJhQ}^] 'E\AO(HHH U&TJ5N2)|{3#YAՅػ˺tsY()w>qڤa6 %HL.k8kkhUĦydm1JHN<;6>æm&nFUٝm[GsqL=}L6 d$|wnʭӋk,kRw_loVn{$u(PO.qdDEq`:7DFnS:T)JK4J9u9-:"IϬlc]C-BSRښ>Ɯ0nUk<L3nY63G7-'K$H;RhøV&a6W*OtbETOg?Zu4:ZWUyIVp]y=0`8$d*um$cuS|QR|Hzj W, #9_-,&USY+J *)&gkx4'V5\veM0k+TF1g4N jyI9IV悥s጖F E~6+*~25ZM͗IRCzAb2RFJt#VKSQ뾫t{xR̮76^ >Z,*WoXtgoe pIt)AkKJk%Ϡ[&euRݠg8S˴0rFJgȔiYVTRj.H6Eytّ粶W5T3yy躵cϑ1fƸpNHt%$r;3J|짹V[eZUr3ъaw}̨֎R[sO=XQLJ1])o:tb. 9mܮ0ۅU.³gգKql|$D x$ j5$S^Oi/q9O!X$%66>B1kkd Ğ-8ն7N-Jk=[n҂RMl!9$8s:JSm;[hPE_{wV漪Ty@.*W7g-5 UIOLkJ k4T7THHi3&f694Tk>, 83RTti]B]ɧYE`- b/S<~ >%={hX8YKc}YKꄘHKWBVz"zۦ<M ȥ)e 믩 :jeBB;x1ܛ 4'iFfsL3&dE 1SH:U;TǕfTu m))#k%$X=JSd/x|til2*̘X[BT12Q+du(3 lHLfpBY [P{OֽB;=s}5F-%9ڱϭ0jgk}{:/{U}"Fɸ[1礳̏R}4':zj- 2s̮VrUAƟAR6A4D:,? A楍i1]=i展oy [ IIU|9GK=TY2 3bZ]RV`1;1T/&4L%ML8ΪTaW b1g G+XROWng}j_[b%R&(lI [ h[HނUkr̍VyoN9skZz͵(XZZNrsk)6Գn|i;;3 36JHq(6d2xR(ebR/f[NXBYe$12p[R׷,BQg9I䷖{䭉ԩofX6gJҵXFu.gاؠ9-2@ys`r#gqxg W\;Z=wѝ9NuQM. mӈjw|i%l)d&l71UtĶ>-֖%H WjRpRR+>,K%2f)^oqV[ceꘐ7Y,70avSZ\Q~b)a);}Oq]yo[:'jصϩ%bUgF UR%nQ=gɰcs}t)uHЪmK{7(p<9-^xa%HJnimfm)B 8g!&dRrm|=@@@@ U/HjMTQIC!3 t!6n $qu*{^F_E1 x9[0Fi!uY|^rSbiJZ\X$"E znZٷW-+ jSgV2y T3΂ϲ2ꆲ l.C<GŪ:қ /Tc<ڲOxb^/I<"q\q1iƈJ""ܼ1Z.Nf}M$Z2M(tN50uWOtE[X :*#X+x:p{KG5#Dp|rطXWCqIPք#N%}yxɶzIXĪTy@ҷuvƣ1I62uu>̓K.m6Kq%+sGRk a)4uKt iT("Dao9-c;Ȫs}].rM*U̚|u搲52nsՏkM=W$KWYg?b8Jx 1.۴)9Zig&izAn.n-xbթڙ:MzwMJtFk☥*3S%%YkXHHHH U 2NO϶]lA)69 8)&w^URMt1Q*ml[\k) u"a7}mg^]Stcq}ɭbq7*7JɺmqՎ`љt*2{߁ꭩ\6oM#r=W5^En]̫s[ISH(䡖[LvEdvҢ;YUyqG]Mid2{UoXnϸw Iˇ"m/J/&$3Ə0a2Ձ%XtR*Vʣ̏+ZNo=`)(cڌL1&E`8ttj}>Fo[8cw*::zRm.uV|( mY3C)E 1eiE3Nז.<k`Be~1ѩ\Mjrf#ϦM9ʅ.I7Vt.#;nq[RϝO#"ԵU\I=!caiZ\g`效UF<ضYxRG^[SyUm[G`g̹1/HN̺AFV *Ye´̪,֓[|RT4:VCV5Ӗ J'[\+3̹QIJnIM³:͝&~4zEreL=dqրPYMj۩riʻ[rhfXVyu˵9ԷOϋ38A%,S%KSJUG]L2Z]hsZuS%ٝ.MzV+hCҮ}I3B+%t3JZuz:4o.ԏ&:~!Cr9<Ȓ׾yp22ii(SVH׺r{Ym2?4Sv9*Kilqrd|[JG%W (ӒvʆMe;ā_ xA`' 4p4q7a#lrVvGUfMs(Jx#p U'o,sԕl">ds&g(Rsj=t|U%oϺD|Wt [;2,dhR ~>stream Adobed              %,%     !1Q"Aq2a#RBr $%&'()*3456789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz w!1AQaq"2 # $%BRc&'()*3456789:CDEFGHIJSTUVWXYZbdefghijrstuvwxyz? B BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H B BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H B BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H B BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H BR!H B BR!H BR!H BR!H BR!M`BM鍑!_3/Znz29^d-+HRN#_PP! @)B! @)B! @)B! @)B!  B BR!H BR!H BR!HR("䜀/E7RL.mzlM ^>6\/clCIx ˏkh}we$ إRJ> Pe*o~EFi !O*T@ﻖ3 5|70,LFRl=]]*MEiNm[YQUܪ)7[$w5"3c621#RI=8nW8i)DPuw?Ka6 pI&³ o'tN !mmM}wܾڑ3zl}TӶ]噋%c{lB[7f4"ޗl3I:ZOY~5>w7͟e_o 1WgAԓQ2KgUr|;+*Mܑ=%p0^4eL"bSy SReB<#feKS&nWJ{tAȕ%iJР(\)& eXȲ_( BR!H BR!H BR!H B B BR!H BR!H BR!}MrHtv2" BRgG8rWִ/P$ `$`'zq歭O˔L&˪mв_VE$xT i䮱q͈vjKH :>ԛJc:;s{h:]SVGzHX]_QH~7S+0Mbum8inܟP_+Z\]F4_7JLILD]ImJ 6,cFeh &a6 dg{fp;.Ƥ.m?T}'Ҭ Cl8ӡ+3aRG`+i2UI0w.ot״,;v* io{+f~(# #ޕH^ -v﵉Ѷl旉By,6 yj>Gӓ ۞EH%s͸"7=$;:lsڜKBډsk^0E͛^!|`F&6IK-Śe3ʸRPKgOrc u&z};@6>7vP dzAYAU{y#>,n:åX{ȵ+-s\>Itw=zj(%uS7&-(\f6cj9CՖЖlecƼ)B! @)B! @)B! @/ B BR!H BR!H B_]UQ)uZ%$$[S:`@I@=sBi(,2O4U=lmu ;Ow ުނ Uɶ*$t9pZw7CÎU}TfD5rm$Y Թl@v /38`2w?:ts,s(ĩZEI &:4~b޵G=Q'Xv=ikw{ak[v@8[)^L ɿ8'~wvѲ tc}\{j:r婎&\'w}3_uL592$\*I%{lcZ\n&5ЦU75n9mb3lt<.U|L@[kBEcmWZ(5' {zZw ʾH &ImXa x]($d5e.=ζ4^#Iqm$zPF@!=3X/iɄyn51ՇQ[H=Ӊn^iyKDӓ f%ԴFꃝ|+ie`)JMIrF֒t2523t6~mtŬRG*{X X'wvMwgY{w&l{v!jNCNй% fDSfQ$swC.SJ-6uZNL"K:N2%oKs )IoD.9#4SibfnܖԻfX5 BR!H BR!H BR! B BR!H BR!H B癖eىP !N8JPJ' "!8q8;0ԪZI#_,65~KMfx]O~L$u]S\A5*:`:ޛRiJ7}pnG~ۖc$J@aS)OIB4ϱձPx>ěO~ipfN tuOi 2Ysw\f(vno{;n8`̼JY?Υ k(FS4flpRR:kO ͳI:q_i)'AAT`qmk* Wo:5>bm~L,y`tWOQ*jmQ/ɾ ɲJOO?k,k}-d]RykW j]@'X DmNc ۦsu~ԝr=.WKaN k&tVc$f$J^yyܔKA3M8óecuXc'иit eL9Ss#av'M qj ]|19\ P']$D{>U4 =WD :8PG8vZR8}%xn;fͪӑ:+=->t/a7iS9i?< 8@d+S=}j.(mTL"̚ wiimW\MIOeҼ6Ru ͉B*XXcčIeMhz lr4=03_m(JFEi[Au;mV$z^B! @)B! @)B!  B BR!H BR!H Bjp6gFWڼUvl Y7r2kf_<9: zƹr_w`xnL˫tܭ~śmKIH<]jܠ wpRIQhq% Z.:\RQECiyZN[XF2 <{Z,B:ROt|QҘ"tpǭ7pvm,;lIY=L|CloܸrC4v 7+*Ckm`(I ahtsdn6\{yyl:.KiD-`Q26 $y7^ĊаK` d7t5}$}^W3# 7o<_~đZJU ޕ送XKtJʎHVcEvR_&l8b۵|  .Be2ђ ii%.qc}:BҨ#U-7 0-2]tm29-Ȑet{L>YnOPێ>^tT S+3VבC*xn[d0S,30Ì *6ZX+ BR!H BR!H B B BR!H BR!HOz2$-e=6cJ.c̲di+l/pnDttz'yIa1W)AWx7Q.k:I [ Ƅ9Jq1Ǘ,&dDcqsiuwoFvе3SG|#rwNO!\G-[άCqgՙ >uHp4b'<}pSVNCY+䋙w怿yk>[lԧُ&=߂U#\&tx/@Ꙟ)x93Toq*[)Ra$lI 7)551"~X֍@]mànY Tm2-po|fsT$t`ۻ8Nt-em P3;Z3jHBi&APQN7 b^,"3Y(^ԹQIC,e!}Iu|_ZABwҀeM򯡷_XUd.ir _X(d?%z,nzv=77w& VTzMA8%<{ޣZ~ Ne1i=}k#%rG{ևje!VinJT_TiR&%Mr ViV댲:`\;Nj%,twI# ;獕B! @)B! @) B BR!H BR!H$=Y"b: 7Y. Zڢ[HdjLu;6~;WO6J_%)8315$^2 m)&spYғRFa;qe\oִ_ya%Ʒ0wӻ0ԼSB\nZl܋Q8Җ[pnDh}*8z{4f&I}x)o'jXqƳVE)pn/`hnаnT6i)ϊ|\!*\x NFU72FѕީP6U#;I+q $kl'؀ znzׇXPY%d~( WpE;m|$bc(_u{X`s h& # $/P$\èeR|dZ ^ڡ$.t)n,GPVwZ <@#5޾2Gt-1v^Ivp3 _$l:o,|f_$-'U޽ܨɌK'&: O $ Nx_!^W:9 PugZHBֽP_OPW c.*CiTRxǏQ Io/nR!H BR!H B B BR!H BR!~ 'pD5HTE7?30Zm#7]ye7 .5jh+bЄ.!.[\ u:`Qzb`Pn{6^᫪afT\=}kl+d1 K.xwj ߚKdXWز.x#3rJSfuK^{A\:fTC6Gk8XjLV::8 % fk& iQ,ۜ{5#u+S[BnI*<]e[Oi^Թn7]bRѢ!}ԢB@kǽW]t/d)1lZrΡ LGۢ"Řڦ2tyV)21t^ѽz4w.8beWjoWrE D_Ŵ y|ә%L!c;.E4@Dw`4z"d2̧%%(dTNd X7qHK3˞OI_o$R”Ќ{h{{-X\ԛrUp'T/P<ꓪihUJzy^{J%@:sZ{t9RF%FrzlLĔZ[Bشz6ְ"euЖ)8Ԇw.xoo9[r@gHL4 U{qa9Y alѴ_rUs@vaR]m Ci)JGR7˻`CYGF(b.k\Ɛ][zMFykqJFIU)Y)D=qaoC ˭lnvC..ZX7_OW8ීϦҏ&2@q9רang%4d2?{˝.b{EchW>B՞ l^*A UI㍈Ikb*m)JI;oitL@]1)ca1f+IQQ&ٕp+Rr=rC,~Nڍ4=pٚQ1RX~q9J_buDw)X[1mײ4ck͒Y#r;x&bvcuש&5_L;JYB)q%< 9G`u毮q #&sCKqv٭ EpCH5ҐPuVqFX?R^Q6k*F'RX/&l,Juu*{ N0!v%ݚ$cyG+%hM#N2Zcnr -Ƚl.$#( $b5 (soLrG lȣk{-6Q9%}2l-3S@?6g !{{#f&/J _J4gCtvIi#U#$n \|MhH17(VZK),S /xZZDe+ks i RRz&6.UwYy m&&),,48n]Zi!FzYshW(5U/8eSGY]pXBĚXP.nfb^zY)؀v/hV96z-{C:qN&sXw.iv5FpuYfRlHn>0\,Ix8uLG"WU3.6 k$ QMZZHtNdVƋ/un{ MOU1M% KFYz"Xmn\p״qӲ]}eS MHML8OH9yEvȍ(QS>pj=.ƖqW6+Ӗeef)2k5'5w8&>eA3\`X(t~MZ| c*NB! @)B! @/ B BR!H BR!xFOR>z`is[QiƳ(*~$ƪ$뎪cRK),I ɰحF^٣qɾW[$`BmpBva['K--}F4}kmRI*Q#"< ZuY]RuF5iߺKYvL)/iH QI@ jKT *rӊid.$]ޙ7> "̥<8fϹQ\WDjmoR21w.^_3u^ jO.niim=FMZʪ07`8)#'0 BVjdF[9aԓⶽQrlyt{/dlMK"eyiA7#fnjwu;3(7GuۢSٺ:Emn*!ϲ1'YE[;nasZZ]\ndRZKD6k46\[zP4L]O QwB;^e0 ,n,aiB–JB>ͪ?;Vh \q\uB`6Gck!{8˥J\X_`hk-xp_csm hwbtׅdrVX)>Z}(:Mm1<Τ<ɶownњW퀖Š\oW F؄o #;]cfH`k/Э%=ƪLMd"EqIۛ PǐKLJ+PxnAaƵ'jU\zӕx,pСY=Q6VI}'j:$CqHSZJXx!}{XPB! @)B B BR!H BR!xI[j9D}-B6dlYJ'Pz2Q R[A)q:QDF~H/}z4ojzrqbܲP0ޏKibߥA;"맭L q*KXRrj/$[5L rB,م wQ;M? uRH;A,re7._m5L$lj CB! @)B!  B BR!H BR!H:sWbVt1k >&V_c1:sW ׎+6K#epk []p .bazL*m-e}{%NKH8W&fi Ɔj4:XwRY#8nmzVlI;r ܁^+j4)Z+VPHZ{z2fnYz"O6^C]sZ"p%:j##BUQ6V5F財z3GWQ@L{F'3#_k7'711/uICjKH+ pAi.~Odo_Bil.,oK;1ѼsLeVү!AA@]Q MBk'ݔy~Eԫ 6ŊxZ!Y) j2M<#$nQBH BR! B BR!H BR!xN5V>܅ksKbqd,:U@ruԭ˭+J\|H ٤ = v}M4 ZNJ)|1Jdv5_7"G.32ys6ٻݨ^96kRμlQUdFW D tL\3y?e]͵up6}}촙pscZfmw'+uՒ:酀nftGTXd)2iLٻVMvב-|iM)m[2#fBP!{4m㸺ԍ Ȕ7acklFi҅e;S|q}pXC/ǍxWtp*\Ɩ!nn,9}nα:sq1s8>f䤎0ߛOIC/Ffj1Q<ʛ}ŐDT x١r8<?n"Xog*8b.c,kZ84`ᨧKߤN &,s5}ֽˈF7IXghbMk:h @[L}bCz"\FI(n*HRTel=(׬+/|2/բsš ;9k'+˚ 1X۪c~;hT;洟JR)J\$l #>G_<6iHO4|U<3sQprhUMi!*6{.wR󮤨]J߶-4fmMR z;Z߇.9prS BR!H B BR!H BR!HsMU.WvUOafˈ}^!~϶Rΰ{r`шmae:x(2g -%$6BP`:'.B$q. FZʧcb #[n+^#Qi搦ܕ\REx` _hmi 7;U76VZB{},4.|AHU3vh [Q{!}’H+'+҄l܅rYD(]Hڌ/yA v9R=`*e2QHI#1|hΫHmGP֮܀|c/mV)Þ; w i  ]\\\ &bGNeyk3]yֆI:XpN4NVzjv2:& '`9 \Qڶ#ā-V1$mao8 Z]pR0RŐ4Mdu *Z&BH*R֬m$#r .;K8e4qJ;=KbӲRt KԯRy,ʪgԔfPuiDqZᴄ܋Bdbn㉷}n<]+.H N󗚝L> nV |u]\6׹WJXJKRUa'8PlL _8R@)C(Lu. R|]q,Oe@r#-+-r-hBѰPB! @) B BR!H BR!z1;-x#zdQ --`2;+ @6Y)<:ɰYUETu k9:UO8O[8sZW[! g(ZXƂGe{9:7E!bE09Mkbw7-eRP$(Q$Pspt(C<9Ѽfi þztRߧI7HU ֚yJ}s'6UNrMg%wWD8/kN}?!%Rh3 8șu%`LM&pt2XYɔ\Pq u赔Nf H6(pj_ Zֺn REXY=-ƶG0ό散ێa-b@$ﵯZe!M)d&Vj'm8MVs=Qr1 $%qAB760Ge[²3'\Q^ԥ}f`lI1$ S0z' z@)fISHΐ7y\;ܮ6KL&'m!4&\epj)7v[ $MT!*C@ZrIB4Jr)T9$&m\Y,Vc,_kV$)B! @/ B BR!H BR!zi725I$g,+@QL)hatF]su&# mgo O:T.::@m:G9D3\C:Uj6t5직nHy.Ez-DmJ)]O18$,9/ˊVҌmeS#{r.RÔ۽±%QI.IQR{ imlx]Ckǭ*SI-,xuзܪ of1ـ͈9(Zˠ6ޞ"TFuaصM$:BXv]}#^χ\"IHDɿ6BI'=S80V{_#㼛CJ{%ǴWZ$(lP-8vfdk[wFf-] %'U"m.!{C2a񬠌#<6ZYBѸa TiUU:PzQl'[3#tn#xV,6)cZ;Jd=h唻])e;[vtqsz8X;OHfI-蒏Ty.HT[$P+Rcst^6oNha<-mV4Zyy*Uؤ4Ѻ1䃔}+3yFt3уl5E5nK/[uj(*QQ+F)%ya3K\[^ƓҬ7K\C&aەTbISvg~ĩOQvD AR7>UqZh,r^캥 USiz P|Rd)?2YC607&34pkwwgM<<]`zZ\ukj r6=LF!m:r#x]9jJl'd#H븦BZp*ZM;fZ凋CcdK?N/8׿zkwnf/gb%+-,M !dZ Eՙ 'zӚg!{7'ܸl. vrfY9w/ 70j2xruTZBJ:=LU\]JFLz'eTF8.<N\ҲMR͉I>WabR!H BR! B BR!H BR!=ǩT,;lÍ?WYTTzeEuܑwP# ;Ayy6iv3@Er{L?6K3 ;cr)Cd9=qW4 nEm:mW& U)H$d33׿86y7jOJXR`Xq0ܗ`(:WÍb`ɺ@M.<-Sѡ_%T&[xmE;ȐM=59P![! |8Tw:Zyz7'^:IaJmB]* }7B۶4c\sR5lC QV.KpSh-@9g ؗė B# I*.dRd엀."/:7[RU1 3y> b& u׳U1m5%FCi[d(fJI+m);Jp8zNpNK\Z|2F6GL:.b\kj:t^znT7^%e?,zV0,9p O+^ƴ6v$)e/;E:)$5VRqNqSӋv.נz/ +K=hx<'V`758h39*[tB ) 9%6F.{ j^n;L^5(US6УbJe>Y;%13˦xӟ - =.wUm\!.'2- F[pf,9s($/e5RcncD'tPbiպl:p3+#N1JghS6JZ4Yݑ-,_P!Ojq=I=R ?l.cEMf{l\sGmJu,_Tw.lC+ N v.HWwfb(V&7$:6J}N ٣B! @) B BR!H BR! JKS TWeۂuԺI=QyOp7Ma4v*gpa#ŹEAa$\:HMo{orlmƦ&Rcivn'<+OŔ',a0CHg jm 7rjf\"cojMyS4#! [nI.;F&ZuFRڒ2@kFf,nd'4F,N*0;iīTR0=AB/G=׌i@+swSƶQ; ;!&WZu)H:#*iBJaL5FCXt.lTqٝĩɍ6l= gJwp-4Tʂ:f&y;yde}qlǧȚ}u6&׀yknlDZͤF wў|M;GZLU%ekrD/vbkdxTSGE{ؘ&m/iqѾFs_~W3X彴]FZScimKee[5$"a^J,w\SpN+b>eйПIvWNP* I 1SmhO<yFdyഡ{z,܅/Bm$ k/Kh! 颴 MSK%@R:uQؤkoKP^襫1йM=؁5<_TU\ujW JJ.w.QAV0]g=>Of{7pab7KThyAj MI?FASk$rH8:ӪkYSdk=#uԧuo\yY*RQ7$tzܭvBX4n@;/J1D^H[Dl (q-[Bs9OSR OA"ޒñ՚;sO^i[g)}[KMiq7]#Feej hQWjvB|&x9C⽈m侠Yi\y 꽶NB.fPw I/j9qit/eDjR3mQ\sZ!}] NPA<@h܁YmKEj1q) ]t-kq eI` $U,mXnDRbQcx$xmE0^7_{OWaUY9YWuyhZMd,RNG^J9NjW0pg:7ldRqv斑k؝aurq)%717ZPmǶlZx,f0S2K.4;^#㚌n_9Ge0@Q ;z[KNqՐFOh.L״n_NI_ kuG;9q\Ի1Q#ѭ ݩ$ץr$jcU6e/^uԃt֎J#yBY"Ou)6_H[ ݛ#kjN5U*~>ȗ7R,*S1s\ee fm^.#UGqЩ:I-gѬ{ƜHO{R_,$lAWwG6dT:EZ~=Ӽ&.6j&`{EEkC2izNWsaJJ˧P[T 1D*fVgIWmJR,aZrn)#3Fd/AAMţ[Ѿ_A3 cȌrh.CxOM:Ҥ)v{sJ\,\[8_+X={v mܨ%RUMKWs'0] dfwʗq6naCU58R3h[ʚB> ䷻%)ևR1~Ц'%TQ5&ʆD6c"F ea0o}odfݒws#kN[mckniԌ6uQip))jǶIRv0^(^V9NH\94(lRzb=(ܱJәнZef(񺑘XUI;:F< MOlBZؚaĜq*G]bD:}u X"qtʑ yc B BR!H BJ Jv$@,BbƑg*+'%:Id<@H%O-ڬF:qyPMnvhS2s ~'UfXʂ4/6#=?ie{is~hTR(s }#vGLNR6i1/m-x)mͱǠ)N1}XuArp$ 5iݭƶirF+ʜOڮ2Ҭ|(@M(\bF+bOb6ЕjZϧvgoL\]>Om٬<ơㅵzz?6|u&koI rT=gt8)57m]Vl ڠ }u)ᥖ;0hGT^&NAشVL(eJvOL8ټIzr٢yl3Mo8X/ % {/r+UBXd#YXM Y۱I=XQd/uVe*78.|h'q3{r8w/˽^Bu PWF>g{Sm2ڍܓ%rmOlaN49GP2-/ B BR!H Bj*Z Zu-:m۸..gLxʓ4TS%%VShN a;afN%6v]XW|W2r$qe.i\^'.MPldq[#r7.ѶqzivVuK#2uvZhӔl #?BbzOUSpBU)ݙtw(wTla =EO eGIXHki؅F4YCG:]zP*'ℊ=z/b.:KL%'rOzHlNckA}f\ ؂ ^ F^Q,'hr7B.3ME>}v\ipsE!crotvm vH֑^YɔJqO bç'f֒YU8nvykpΜ w^ֿQA2ǝȫyEG|T1pQsq%ěNxT ͚ZMcFiDܯ3I/lJ]*I'eh_rakԓwҪ; :gī5QG6>5w}tsFb8qПKDI gy2<ṭ_Hj̶Rn#v'vs2OpAdqǾ+}." ܂L e*I]kXnt/ۛlϴMMAȩ)(t6x^Dnw.%.Nإ2 Fn B BR!H B!s\)@NSJ*"\E[k#C}%LtF>,kiㆠ\$f-#]=7ϵ*[y9~;%7MxGSmۇOBnOzl2j*X +lwV4A6^Z%j~-(~E(mWc ~'qJL{I!t Ͱ]]+ HMP-m#^%C ^eCi= ]bh4T7\xޙJRnJlTi*{捐y┘ ҵW2$.8yn5 pq9E@\9gx\!/sT#I_aZ$[n}(L>~坧] k/2%9l.;MFG`lB֥5XY&QJdB !wk辔/Ֆ-igFԨlP82B;^,ļĺdjZ'YnERGH3T۴# M+q\r ^ZZ# òs U,l`aЀWUE8c8ī2:}"/?#-,^܅Z}q0OUDL2ʛx8 HE {jo UD= d& E8r+HAH@&_`q }&̅΋LJ7j2J; _$8Y 9ۉ'wP~v6+Ь+P˾m5 6'i퍖UOR  B BR!Ht ,Iy;Rq6iwURYu᮪& [.KPuAw M&/i6īj*fֲzv$-:0\UĬK\IBٝfe5k0ؒ +P1u.U `YW7JdY^'.RSm>#Q@CL˝FJ&F:AG4f:tB!i~UiJu{ S~ՙF鯑:"rzKԨA K8I#Y­"bQ[Ey .oо =Ŗ%QuE;^Jf,w&V&']B})RIUAJV68fV~licsbE/pí_6{$k bo-)qq{ ֢x@tiQa܍OI'Oa9niȓKrmU't';56޵*qV4]C .ѨHL6ުZUb'Ln5%}t, { +'‡qbra&rReW1KŻ\4ɫ$ۮ,]aٳtBz/"^Mp,v+91n )3)${y_1PJBkW0ȲD jEZ{ng C ŸZw4o>D[4l$9Jeq2ZS +q)FQb7p+zy9.qpT0%q|[ҰU3sAx)W:7VkӁina-M$)IP'wk _[j<fonKU+gxᙠԾba,j~+MF(8JjSs98ѦWTh,F͂"Ca+C< cLX١ɽhXq1ѳar'%ܩGWOn4zN'U%k`wj_h)HU`B1siQ3q0%}hMdsZG2Pu:{t)\tI 6$#;5 bo{6Bk󀐽 kBkGPD3fQQ}Pqꂠ.cq^AB B B^1m+\<aq|@ ъ[44I8¥33*]uO C~Һ=>:xZ>pkuWqߡVR @z`yZ/skt@t-.4PJEI'x(ڴpv&ԘEoy$5ִwʬu1I<\i;wGH9+1{ ]؊MßGZ? áu *4N^q<zMR%`)&!iUU?QN q)w|/mT;B|eлz"Mc,`14H30ӺF܍<6aڠŚ=+݃u*cA::RS}AKaNP-b/ xo= RG卾Wfs)RʕmBUX'2䃰n`clCGWmB7B<,%w#p>=yUʍZe0o[b3B/cX;UB,]yVM#iz'h'Ƚa ؜ g-|l3C>^_p۠((c{JDlQgN59bBj3DW6#oV5ouCd/ެ+^ExlCrIh3^{/Le/cEąhQT ZFc-WQKGh*oeBḂysOk)k0ڼLWj3TA_[M p8G FPP;;YX]f%BUUFH!).b %&er&9+yjm 7VRyhg[گNQHH؛_iUɛȻmTpR 9@ ߱_(*%5&ʆФ Ζ\QCw ll4`y7f tin+f,R3JI@ ic0"=vz< i&uX RF*v^ǝ UƯ$8$^6[}o 8yy01=m}6~n)%qp$%U36A)BFԧNjY@ŇQ4;ܡ#иf]Qx0@k\fEST،7Θs"YjzJIq\&sVSԊD)FNf c%R/#ͣg[9g|o=wFdgU&sEwh'djcc {,ݝ;zX\zWzLm52z:fM>P>wt,._1KRC= {8{\2rRGڬ˺_r9 n˩mW.S儂̣Zs#àSlk:+4N(_(u;jZgOÅk`o1ʔRaA,gm{% $Sim#WP@`ld uEhz8&,mE.״#a4z͜ߴuTۨ IH+ZiPՍi{3|U~R.b:\\Cچٯ8 kaqKIok,.m#Wg.ҐۮLr)35B 7=H !|ʀv> ؕwǀBhI $lMPЛ hw߷UsJgw.ՠdzʕf"~lF#+=|)MPת $ A`@gw r{-2-ћд!Voh-G3$ܭPP9**7$1p@#f /WQGy~UJ9b:,cQhner|qg]bdn/ حUشJ. oǥL<:X0DN[ /r\r-FmeHKRQ mB%5T8DԳF#6\~U<[MRes n34Ox1ɫs ;5[YLH[.1ӽo.ʖsn-^K$-X$ΰJ˓w$as~2 ef:_5_c~l'*VFF nUGYW[#WLJ6A7KbFIMJT\0C=kd 8\.2fPF[}4, 6 .Jy㈱ PtLHC*^ㆀjg't7DtV$se=Q'} };ܽ;Lu]<-+Q ePmxYjMGIhG'C~6 }b#͙DuM(-@-(+:[rgw30X<UZL-IHM]+;IQi0:Գ3fGO΍\ kۨ$ MǝY]$fd_h.R^VY)j<񻬜'Zv&-]mH>,cp>z=QkcuRPCM@fpVh*u5Gʼ͡ s[pRݩ1 A{wtrzaX)|tLȱNg.$ PQIlX7}첕dbL{Bq_C+PmmJM)oKA_I endstream endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <>stream H|TyPWﶧC{̸+F"rDPhc.G 7hXEE#*FHDPCbPrf_OR[muW}HB2 I.0L]:uxTN;'ٸ?MJ %iYq?nZmNZdKP$)2zz6Qd&.r޸\0wqrrQ+)Y$DjuZ]x*ʑ_*x*IK5nNUXc"_uQp]5?xu/'((YLZV") :*qΪ]*ލRE)~)IX04 @'1ׄ~fDA|L" b 2 L~D N|K!ޑ 9& z0a˄sM}J}+qK~諈E(U&&_K225g~ꙵuMMM۷(;s;(뙒$j"E~' c q= /,ؗ&c5x`#513cKvɔes/+;QīÞ-+K~@ S.Iİr 0<'93 -h#J4Ӱ#mB oa+( BUMٚ+@ՎاONJ]d B+ϗ?n-Y `[_QU[RlY;6p$+0io4jIjzȆP ,^iku=Xk8F [s{B$|3K={h)M5(w(8ʠ_~V1yz᨞d(a#zWk 4;-)?nVԛeti6݊M'}0=XX]O6<>Z(kKS{ yVǸً;FwuarݺtJU3"mHY${=ة^:t)#JKtƀ<$ V< /cًmzKK4M^,Ҭ;h0Y{BZe`M!l٪3cKU-#}=ǸĺH_G@R6pOh`¶ ٴ&[󍦶Y~%~vCS98yt4dޯUW]aʁ [a{œ7k~ye!.ٺc֘?KNٝ/,՟Ze?S%aS+]/bKL(a:JGv@͟b5];]<~~J*<(LfzRmǡd?)9=wláǥ'0tvҮZM:&d"x?-:\^xF1Шu_6Cֲ=Ɨs"d]~a*ǜM dJ/;۹}e}s=]^sŖX&~cfɱz%6Y¥^R)U]~~fv{|,$ވVcZPN(+Rvl1+)(hIsLHr@'J&8] qBN3qt]\rV,No(gpe1+^|n@ (XV z\GNt {Q};*ȳ灝xY/J3:Or&((.T?c}/5S(?t +zZW|@!,ZVLso'=/U27x0QdŚ WՔkX1*X) *յѪkLg{QQobGy66ޱ++] y 鱛WlrCdDQ Sj(qXG8$y71BZB"b=ސ|}'gRqB8}De ͡>ʯi߬0&}Y N3}1L|sK1ڸA?}kl8.s}ҼOqQZz^'TTi%h˕}̝sEv7Uԅ-.Gʹ`F )Wa)gdr;NOhb%??}c/eZ~cߩo,8WȌK^yc36pẘDCnR 1:s:2X7zr-%yiipD٥j&dc@ Aגh/NqRљߟ( W˰Rb\:qx`!! $je  /& oXlt\rk)D/W$ -g۫0OTF!/{.ÅA/SK}""c%Gp[bA`0߅ ^|04u@c^QpX ~'(;Ҷ˜ ,}Ѣz8ǧ?ڝ1 R0+rrK^\Ú Asy\X3_l rbscEi>o;,ƚ]Z[hDT*Mxi,woSCvzL@蚵5W2TY-A L>PHcC+0A+0͚TAdTHjdq߇:}% O8"'CBxGOM:=ß1]^Ӵ`NsH粜!5d>h#|׋^[vll?ys 4xK ,Kn2kǁO=ce+UT[۬`jDDUƝ3i6@9g\|2{@xO8NQcX7 x]y|8,'18 U ߹EUI3J`vc1Vī%oۡ&9aδWׁL.Iu>!\샙{v o1_d;W ̯oVHscsd̮JE3f78VT{ɿ g2`^\|HiC 6Y53hw{bZo?E32t .W6ǃqԍSt(WȯѰuc~ϐA 3v H|i(Zv5zt} }QhᢐS؆ed?q*aILg- eh;кW6е/1Aŷq/gV<1#]G'z?{_ ؁Q~td^^ YiLZK9E--&A[#,| ֲa<2ĚIɛ3}.T1gckZET=mԴrDIBHIE>@|#9R+Wńpq{O{4qܩdi+(ExI 漴8[:677Y(byIR_4,2* 7q8o:mQ({|$ ,—m@VdmrBET5f+cex@35da4|F=~^)U IE=Cu{-TV]SS'3{sl#VE(|ΓA#HM\iFVM\G3:ޡ+s*J&1䎋p>/hSoln'2-X$]*`'܋]s3 rBxXlbl_ށ3hyF< fDI42de yNR1;rq1A#G%hh4Z0Ǹ8[[]Nuq0 K,ںVYDzzZlS[n&j5QOR O1E 4l*AxBC{<_|D Ƚ>\12 <wYmP(3XMz7J?'EP)H7C'<;F1ɮ &`༆9kEC+kqɟ(Imos~ +kzEt-f%ssN[-8h7wH[yC>J9ݚ~GvlX!>ð4KN+98q `H:ﵱsz{O^..; endstream endobj 24 0 obj <> endobj 25 0 obj <> endobj 29 0 obj <>stream H|TyPWf{FhL屋ȵ\^x\"h23DI rhd5+"FKVtrQ,5>lVWq1|cXT@7Өb]Y1 ޽{J5;YNC`&x*MMMQjTjM:UFƒJ|}ݝsz;]]]|B'gUJ^iQ!?E&s&|~юcyCW0W~!G0d<ֹ52; ӶLN\/OB/3`ҕn=bFm ˏa)wAӅ"Ht;=׺u/q?(ꫬv8ڇ=C:8Fs=zp)r,$y;HƏyJcvڥs؈BOiƬJv(1,1\K\} v}%|v%j Y4]7%֌F(?!2#J|_xJxN{K."+׾ͩOL;\Ґ -@;rYYhӽ?IG{KN&=PG}ÂI/']8ߡV?A"stʧ=!Oo_BQOmb~c⨛h#a&<?%"b1< ]Ҹ` Sp:œC2C~k+n;nE$}I[&cTt9Dp~ER:6:<A%⳹礃J믳UէoޗKąA%`,;),3J_4tw ꔬ/UՙEtkt2]Sj$*%0 *-  dWemLn;0@kbٗ6BӨ8c%Q?̇Tp9*KYA9G2Dy}{~M G.:qޑGo8`#:(RW@'lp%0(~``1g?a#j|x[=HԥTJ UR&E5 $HOM?R6)VȸK/xfew|v߳NLN w?`` "2֫R>Wla1cj+jZqE(~}qg+bϣ`a@QSۦ.[q֫|^ `ı!@!%C+=Pz,jFh<~۸: <*. \GMku! uA=\マEm:ee1mMG׻[J|hu KHHl'^Y?HVNRiO}dV`fH~]Kz-gv.Qi~^}ܞEʇ76u?(HJsml[?/xP}'D/,nW_Q0Ae^ddgyW7Ha1r1*]"o<)3=4ZEBNgqi ;R:!eg2PqO[/عg yt:ڗ*ry R2?2Q}Z|rqէT䩀qlIU_lFN\{Ds[BI}Gr7 ޹ V۬SťfKӐr) " N-gXQ0G_(̏ aEo["~B|(&.~M"xy,_B ##`46`FczHS. # גmW,Y#{o]ggӭ5^#t=`|,qiUJ̒ImVTOboR,A j 4 *c ތpJƐJIWVVA8ԛd> VAĊPjQ ':1 s.Bʏ9枞'h,x'0w$<&\P- !5[TW5%ѬOstOIi%lxfyI:5ejH֚wK<|褼𖽩B&;vYfԞQ U5%r5֭|uvf=.U ڪR{* 8/M ~[~"wӧϗа`^]֞딏eT-]_;yJ5Hό) )^| cv|)k'b]Z>iWB SjX,mY"}hcM_hY I ܇ߕAYO} -9U_x>?s0 *;wkyΊNȏK͜>J6am/NhmمYggLt)?y{9K [leM]77[WϣN3}dokWEgi_ӿM>}tioLg[}1~SE~02 endstream endobj 23 0 obj <> endobj 30 0 obj <>stream H|UkTSWpn"H/"r#RAqVJ,I( Fy?EQBE|Q"Zo'cPce57̟5뮵>;뒄AsԒ%!+f2j2Tڠ^IRL)CrNz+3ي+qyѿܴv{Œ$ZS$$ꤞ^=K<<<ƣtRF% Lթ6J5VS)gI'%I)RZUJfJWT*Uu*TyJ)iJvTc\Z>z9.酙646?i7ě6J^FS:VFůAސsp#S>>OpGkGF),i6TL*JK#JjG#!@\iK5R{4fAOx"n :GAC!H? VmI fя%7k].[rY>`\Na:,ل(mj:[{_lx Ă:R]T~7׊-"Grxݓq~uUQ÷qKBw9ǾGVenid~al %_F}r=hwM63CĥeET܎[RxgMAYn,LkDsWwW޽%'*~[/g)?ʲ-$I\eAi l \Yg<q`_~^+> 1<V7GJPNJniNAW{`{1%H[%OuKww_c:Ʈt?Sj[؂%%U"A3o#ZXf_;wTcHһ;SU@Lc7~~DqE?8<2BKڸ^hNCߧ%i aOu-~5A\S{+Դmj&\w{ xw߲*Y6,<L1[ÙĪ&DqBsab 9= i^ 썧at[gp|flUYiqiXOid#|lxpMFRUF4*=7_fjS־FiS3[ؘT^u 6{Wc$V E?%:mLWoEk;qA=n  .-^i{8(UYYQ#0s6<^?R]"ؒnI$LG8; p[@ۂ`A<~tۼpj}%ncJ'C>uf4 a?F!19=;d ` &94R}9_nmf~Fn:"0V[MK*͚My*\Q#*=\t/tK@l}\bna<-$OQX+G9!}=5XK&$yԁ{.1mK5#5Zdc])=DnTb Ikrh< E|\ AVֲ i* &tx.,K} ^J*ljT3ʚ{ӚNs.7ME"-DLDK3(s|J)?}}wZQj-" Ag4}ǣ# [ n4y,iVXƞ;o Dr|V?`uLCa7;7i PhrGKLgZ9+'OHv[q^%4 W7oE  &y8E\tCRdk5ZQ0UL: 'xt!1 @5Goբ3Xك1v{<@v>Af)%UܳV |Ew?,y<%HE>(y'uܝDNwVlҶ&A+6Ƭ֬2t5/i6tCA |v4ڜhM(. bdAHU$gSMXipiMf><e2h&wzM4X -2 kapj_ZbѠlTªrL؞JCm24B5"c6}1A׵ XU,[h"(@ul5wf1͙haj[7KM?:цChR}0 &Hoopy v,m̏h o8|vYG+oPҹ_fbc"B1HW oGgZjp >ϽVˡ-%oRGT(վ3VD?8iR endstream endobj 22 0 obj <> endobj 31 0 obj <>stream HRkLWaY2;;tfj"Z5h+",*b@XꂻhjdhjEb[jD0UKf{1,MM||;1O qMRDZӧdg RCq$4R/FϺ?Ьg}jtɯ32saGkDo"k!DiҜ#.5 ًeF.Gԇ Kf$ES˓`0 !'S4 :aߛDcť:bc`d-aNrd,CecE9&h0{2QPЋS`q,&`Da0l:%`X3 , ;9<oEcd`@}%Of#b"Q(R"K.M%JTsJW;J&kA0?t;l2? ^w/VeJK֩uBcޟ,Φg%މnckht7o~gkM[iJNIJH-mK9+(,[Nȅխm`,i}%'Nj V:F}"=y "q1F&> 4t}tcoVǕt9]5Ŷ\5cq_ř?o+sA ӢP \I .Q\1dy F< M9)@ɅtMT=fR ڟvrQl/*PNP?x,RHfGc.s啄#hD# k+V>$VF~ly6l'ގRB[&P?;az/W\qL1[L>vtyЯr,x )ZϕH*SjQ4$rrc9wĉ< *8#$.s9I0LgONP pW: 0E dau+Ln4 cF7q]wɿ(Aiu{Rl"歎 G9X~p[Y^R+KI7;ڋع2z^IdY=9^VAY+Y;v߳"-d"P񐔽TSwӹIt RKy-73-{OGPtl#b`S endstream endobj 21 0 obj <> endobj 32 0 obj <>stream H|TyTSg/{P5{#("`YTTDJ03.UTQQ)Y *c-2ZVǪ=V3|_ss߽DD$13}܏B5efc^kOջox%a7bsdZ 9?!"f+WN s˨!GFDD (^6 y.\o*2'\~D!o6_ፅX`J#o6"sސe^oG?Pc[ѭ+‡|IVPtLEfp*y?rċ$1 DPKI" R BED;A#o bfZD_PdI"PaڇNmwO<9ٳ}tX+^6{}{y_ovߗٶNNˠNM"TU485%. hģK ?I̡=$ B!&Cd4d'W\>vօ s wq2R\* z^}GwOg^ѢmI*Xܱ!Ra;2E ~ݱ a.6 rtg==%Ǘ$3(#_`lzY9j+qNYn3C -;Q5ο[ E+NikM#/FCWG4ʄ Wӎ< _̳ 3?޾$g-*OwpqTTh[Yy"M2~L蹯FzKY* Uc4w `lA8bd$Q:&V.Җvj;Y2c UwZ2,h -.8":_x:.l-PfZK8ԈtdT),`uI!v Y3v3u™2t\1I;L774T?`9x ߌ̏oC\8ecs=HmB8^ntmA6c,HN5]$G9A{͊NeL7z[ډ|kfl/Rv̛3,4b 5Goteadޡ(k?+.E64uG@+'U lpH3壻5ОrÊ*A[pEFp@y[VYAe9Sf6ryI#t牯 m[GmW;nj xO'22Qc4j*:{zrkƇDE澲H-94z6fdrS}B rU}u -m:fs0><]Y@Efgl`;~?UTANǭA0 ` >U%=*=ȼu*QBfv}PKJB "vO/e F+#6Hy'*LƼ1utwދ#'a./[HGw:ԹܗtV\k~ۄ]V/ ;C-~eڻL y#y#1(S kmIv&ϑ' $jNcܢu^)"x'{D:>[r}CH曘:sT=&(I^/e3b_QB\S,R{t\<<9ARz)3h S+r8RIͅmXiMOqUDNZPC?B*RYނC(ś8?0P&?͎?6CJSˊQYed28?䆇nlMRIe*yx(ë.?ɧ endstream endobj 11 0 obj <> endobj 8 0 obj [/Separation/PANTONE#20200#20C/DeviceCMYK<>] endobj 9 0 obj [/Separation/PANTONE#20446#20C/DeviceCMYK<>] endobj 10 0 obj [/Separation/PANTONE#20442#20C/DeviceCMYK<>] endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 34 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000079136 00000 n 0000000000 00000 f 0000262202 00000 n 0000079187 00000 n 0000079611 00000 n 0000261643 00000 n 0000261827 00000 n 0000262012 00000 n 0000261530 00000 n 0000237385 00000 n 0000238076 00000 n 0000238659 00000 n 0000239328 00000 n 0000240027 00000 n 0000088772 00000 n 0000133174 00000 n 0000179840 00000 n 0000202513 00000 n 0000257160 00000 n 0000255228 00000 n 0000251828 00000 n 0000246469 00000 n 0000246577 00000 n 0000240739 00000 n 0000240823 00000 n 0000241349 00000 n 0000247086 00000 n 0000252235 00000 n 0000255568 00000 n 0000257600 00000 n 0000916611 00000 n trailer <]>> startxref 916905 %%EOF